Triumph of the Darwinian Method, continued: genetics as function, function as history

So a powerful reason that the universal approach to biological questions was inspired by Darwin's theory of evolution (descent with modification), is that history leaves a trace in gene sequences, and gene sequences reveal history.  Even a sequence that, statistically, is random by itself, is very non-random when compared to other sequences.  That's because all DNA sequences are, in the history of life sense, related.  They may be statistically random along the chain of nucleotides, but they are very much not random when compared to each other.

The same is true when we look into the structure of a DNA sequence, where once again history shows why what may seem random is anything but.  Again, it is the Darwinian method, and the assumption of common ancestry, that makes it possible to understand this.

A century of work has shown us that DNA is related to the functions that go on in cells, in ways that are essentially common to all aspects of life.  This has to do with how those functions are encoded in DNA, and once we know how to read the code, we can also see both persuasive evidence for natural and other forms of selection, but also that make sense strictly in light of life as history.

Here is a sequence of part of a human  gene: (gastrin):

We picked this as a nice figure showing what we want, from a human genetics textbook by G. Moroni, 2001.  The nucleotide sequence is in black, and the amino acid sequence, or protein code, is in brown, written under the nucleotide code.  By itself, the DNA sequence appears just to be random nucleotides scrambled in a row.  But here are labeled various parts that make it a gene: where messenger RNA is transcribed and the amino acids it codes for (brown), where the regulatory proteins bind to make this happen the TTATA in color), and a signal for where a string of A's will be attached (AAATAAA).  These types of features, and others not shown, can be identified nowadays just by analyzing a naked DNA sequence.

You can go to what is called a genome 'browser' (the link is to the UCSC genome browser) and see the many structural and functional elements of DNA for any gene you can name in any species for which we have the DNA sequence.  Here it is for the gastrin gene. The top lines are the sequence location, then the gene with its protein-coding parts (dark boxes), connected by a thin blue line for the noncoding parts (called introns), showing where the gene code begins and ends, and belowthat a grey bar whose darkness reflects the degree of sequence conservation, or similarity with other species, and below that black boxes showing the location of various short sequence elements that are 'motifs' found exactly or nearly repeated in many places in the human and other related species' genomes:

A browser can show many other features, but a snapshot showing them all would utterly clog this post (but, you can see the results for the gastrin gene here.)  Note for example that the coding regions are areas where the conservation bars are darkest.  That means that these areas are also very similar in sequence in other species for the 'same' gene. "Conservation", "same", "coding regions", etc., are all terms that refer to aspects of DNA we identify by comparison or that are similar because of history--shared ancestry.  And the reason some areas in and around the gene have varied or changed less during that history, that is, that are conserved in sequence, we know from all sorts of data, is that they are  functional parts of the DNA.  As Darwin's theory would hold, they are important enough that mutational change in the DNA sequence probably did not work as well, and did not reproduce as well, as in less important areas: what Darwin called natural selection.

We know these things because, after many decades of research, we have learned that the general features, like the code for amino acids that make up the protein (here, gastrin), are essentially universal: that means that we can also find or identify these functional elements by various kinds of experiment, but the methods themselves derive from what's important: our ability to compare sequences of genes from any species or among species, and to compare sequences from the same gene in different species.  Genes come and go, so we find the 'same' gene in sets of species that have diverged since the gene's origins.

Because of this, because of shared history and common ancestry, what by itself may seem to be an entirely random sequence of nucleotides, becomes understandable as an entirely non-random sequence when it comes to explaining what it does and why it exists. In fact, non-functional parts of the sequence may accumulate mutations randomly without selective constraint, but even they are transmitted faithfully (with occasional mutational change), and hence bear a trace of their history.

From the point of view of the Darwinian method, that is, the aspects of the scientific method that Darwin's insights set rolling, these tools that are related to life's nature as shared history are fundamental to our modern understanding of life.  That is the triumph of the method.

Thus, a truly random sequence (such as in our previous post) would not only be statistically unpatterned itself (which is what 'random' means), but it would have none of the known functional structures that we know the evolution of life has produced in all its creatures, large and small.  That's why we'd be truly spooked by an actual sequence that not only didn't fit anywhere on the known tree of life's creatures, but also didn't show any elements that we are know that evolution has made fundamental to the nature of living organisms.

There are still many things to be debated, about how to interpret various of these DNA-sequence factors, but not their nature as products of history.  One can debate the nature and role of natural selection, or the strength of effect of individual sequence variants on the traits (like presence of disease) of the organism carrying them.  We write all the time here on MT about over-stated claims about genetic causation and how easy it is to concoct adaptive Just-So stories.  The Darwinian method is so powerful that it lures scientists to excess, to uncritical acceptance of scenarios and claims that go beyond what really is scientifically legitimate--in some sense, just as Adam Sedgwick accused Darwin of doing:  assuming a theory which no facts could erode.  That's ideology, not science.  Scientists may indulge in such story-invention more, if anything, than Darwin himself did, so strong has a simplistic selectionist belief become in many quarters, either because a notion of Darwinian theory has been bought uncritically, or because as in many public arenas, education in biology has been a kind of Darwinian indoctrination.

Iron-clad theories are self-fulfilling, and too many in science and the media, buy into facile stories.  There are many ways for differential proliferation of genetic variation and the traits it affects to occur or for variation to be distributed around the earth, of which natural selection is only one.  Temptation to invent stories notwithstanding, however, the aspects of the Darwinian method that we've tried to explain are so pervasive that there is no serious doubt about the historical nature of life on earth, which applies to all the competing explanations, and the fact that to persist or proliferate systematically, DNA sequence elements must have tolerable, or advantageous, function.  It should not have to be pointed out that this does not include creationist explanations, that do not require nor predict the kind of trace of history that we clearly observe.  Biologists are not arguing about the fact of life as history nor that that is why DNA sequences are nonrandom in ways they are nonrandom.

Because evolution happened in the past, we must triangulate our approaches to understand it.  This is  why a mixture of repeated observation--induction--has been fundamental from Darwin to us today, and yet why deduction from a theory worked over the years by observation of DNA, leads us to predict what we'd find in some newly discovered sequence.  And for the same reasons, why neither induction nor deduction would help us explain a truly novel DNA sequence.  Scientific reasoning, especially when most things can't be proven by experiment and result from past events, must be a kind of social mix of various people taking various approaches, and combining their findings.

At the core of this mix is what is known as the Darwinian method.  In a profound sense, whatever we in biology argue about, it isn't that!

Triumph of the Darwinian Method, continued: genetics as history

Is a DNA sequence 'random'?  How would one know?  There are several tests for randomness that one can do on a DNA sequence, however it was derived -- there's a discussion of this issue here. For example, one can go down the sequence one nucleotide at a time and ask if that nucleotide can predict the next one in line.  One way is to ask whether the next ones are A, C, G, and T each 25% of the time.  That would mean that whatever the current nucleotide is, the next one is just unpredictable.  Then one can ask the same for the nucleotide 2, 4, ..., etc 12,287 positions down the row.  With some exceptions, such tests for predictability or periodicity would fail.  That means, the sequence is random!

That is very weird, since DNA is responsible for organisms, and organisms seem to be anything but random!  Or, could it be that at some higher level, organisms in this earth are, in some profound ways, 'random' in structure or behavior etc.?

If I give you a DNA sequence, and you go into some program on the web (of which there are many) that searches all known DNA sequences to see which are closest to the test sequence, the expectation is that it will be an exact or near match to something known.  We have DNA sequence data from most branches of life, so we'd 'hit' a known species, or something similar in sequence.  That would pin our test sequence on the tree of relationships which to a Darwinian is a tree of life, and the key aspect of that is that the tree is the result of a history.

If this seems obvious, it is at the same time a profound reflection of the only convincing hypothesis about life, and here our method assumes a 'tree' and fits a sequence on it, and the only reason we can do this is because life is history.  If the sequence were from an individual already sequenced, there would be a complete match.  If it were from that individual's sibling, there would be a very close match.  If from the same population within a species, the similarity would be less but still very strong.  If from a different but 'related' species (say, two different forms of cat) again similarities would be clear--way more than with a bird or lizard or maple sequence.  This is only because of history, and it is only that fact that allows us to make sense of DNA similarities.

Suppose you were given the following sequence:

ACGTCCAATCTGGGGTAAACCCGAGATCTGAGGCCTACCTGCAATTTCGGCCACACACAGGGTGTTACCCCGACTTCAGGGCA

Now, go search the data bases for it, to see what known sequence it's closest to.  Here is what you'll find if you use a common tool, called BLAST, for comparing sequences: "No significant similarity found."

Now, since we have sequence from basically every branch of life (though, at present, not whole genome sequence, to be sure, but this is a practical but not conceptual problem in our current context), how can our test sequence not fit the tree?  If it really were unrelated to anything known, nor within the tree of known sequence, we would either have a sequence totally made up (which this one was!), or from a wholly unknown branch of life.  We have so much data at present, that such a result would be very spooky and unlikely.  Mutations arise randomly in DNA, relative to their effect on the organism, but even this kind of randomness is inherited, which is why even sequences that, by various statistical tests, seem to be random assemblages of nucleotides, fall into historical relationships with each other.  They may be 'random' on their own, but not to each other.

A sequence truly unrelated to any other could deeply threaten our very Darwinian foundations!  That is how strong and well-supported his hypothesis about life is.  If that is a failure of induction, then so be it.  We would go to very great lengths to find other explanations for our mysterious sequence, before we would even begin to question the hypothesis of evolution!  Would it be less weird than current allegations of meteorite structures, to suggest that such a sequence came from Mars?  Would it resuscitate arguments about spontaneous generation (see earlier post on this)?

And in another way such a sequence would be at least as profound, or perhaps much more profound than just a missing relationship.  That is because, on its own DNA sequence can seem, statistically,  to be a random string of nucleotides--once we know about history, and have experimental data (which we do, in profusion) we can see how utterly nonrandom DNA sequences are when it comes to what they do--that cannot by itself be 'read' off from the sequence alone, without this information.  And this information is essentially connected to Darwinian ideas.

This gets us to consider not just the fact of the tree of life's history, but the functional roles of DNA, and Darwin's other idea, that the tree is built by natural selection.  Comparative DNA sequences, viewed through the Darwinian method, also say something about that as well.  That is for next time in this series....

Did Darwin run a pyramid scheme? Darwinian method, continued

Before the period of the Enlightenment in science, roughly starting with Francis Bacon and Galileo and others, about 400 years ago, a model of knowledge (among scientific types, at least, not farmers and craftsmen and others who actually earn a living) was largely attributed to Aristotle from around 400 BC.  According to this view of how we should figure out the world, we were hard-wired to understand the nature of Nature (sounds like a lot of genetic or Darwinian determinists, doesn't it?).  Thus, knowledge could be deductive (the classic example of this is 1) All men are mortal, 2) Socrates is a man, 3) Therefore, Socrates is mortal).  The basic truths were known and were in that sense axioms from which predictions about facts to be found could be deduced.  In a sense, the facts were latent in the assumptions.  A theory came first, and led to many facts.  (The BBC Radio 4 program, In Our Time, featured a nice discussion of the Scientific Method last week.)

But the Enlightenment turned that idea on its head.  The idea was the scientific method that started with observation rather than inspiration, and built up a pyramid of understanding.  First, by the process of induction, many observations were made, seen to be consistent, and they lay at the base of knowledge (All the swans I've ever seen are white, therefore all swans are white).  Other types of generalization built upon this base, to the top of a pyramid of understanding, the final theory that we infer from facts.

When Darwin published his theory of evolution, of descent with modification screened by natural selection, from a common ancestral form, it was a challenge to accepted wisdom.  The scientific method was well established, but religious explanations of life were rife.  Darwin's theory certainly challenged this big-time!

Now, Darwin amassed countless facts--it was one of his incredible fortes.  From these he inferred his theory, and on the face of it this would seem to be the scientific method if anything was.  But the geologist and former friend and teacher of Darwin's, Adam Sedgwick, was rather incensed by the theory of evolution.  Sedgwick was a seriously Christian believer, and could not abide this threat to all that he held dear.  He lambasted Darwin, not explicitly because Darwin contradicted biblical explanations, but because Darwin's theory was (in our words) Aristotelian rather than Baconian:  it was incorrect, old-fashioned and not real science at all!

Inverted pyramid, the Louvre

Sedgwick basically argued that Darwin inverted the proper pyramid of knowledge.  He claimed to be using inductive reasoning by bringing to bear so many different facts to form a consistent theory.  But in fact, argued Sedgwick, this was not induction at all!  That's because Darwin used the outcome of life that he observed as if he could draw conclusions from it inductively, when in fact life had only progressed on the Earth once!  Thus, Darwin was taking a single observation, partitioned into many minute facts to be sure, but was generalizing about life as if evolution were observed again and again.  This, said Sedgwick, was old fashioned a priori theory driven reasoning that Aristotle would be proud of, but it did not have the empirical truth-value that the scientific method was developed to provide.

In various discussions of this topic then and since, it appears that Darwin largely conceded the formal point, but of course stuck to his guns.  He could (and we can) predict new facts, but they are details that can immediately be fitted (or, Sedgwick would perhaps argue, be retro-fitted) into the theory.  Yes, there was diversity in the world, but this could arise by other processes (such as special Creation) and the theory of evolution was not the only explanation as a result.  It was not, argued Sedgwick, properly inductive.

One could argue that we have used this theory in so many ways, modeled mathematically and experimentally in artificial selection, to predict formerly unknown phenomena about life, that the theory has clearly stood the test of time.  Many facts about the one process on earth, could be used to generalize about the process as if it could be repeated.  We argue that different species in different places each do represent replicate observations from which the process of evolution can be induced.  Or, one could argue, inductive reasoning is just one way of getting at convincing accounts of the nature of Nature.

One might even go all the way with Aristotle, and say that for the very reason that evolution did occur, our brains were adapted (by Darwinian processes!) so that we are built to understand Nature!  The argument probably wouldn't hold much water, but it's a thought.  In any case, the fact that evolution only occurred once does suggest that the idea was cooked up by Darwin in a non-inductive way--even if his theory was built upon countless observations, but of one single process.

The triumph of the Darwinian method, to use the title of a book by Michael Ghiselin that we posted on in October and November 2011, proliferates throughout the life sciences.  There are things that this allows us to do that are not exactly inductive, but are close to inductive reasoning in many ways.  This has to do with the nature of variation and how it's to be explained.  In a next post we'll discuss this in light of DNA, totally unknown to Darwin.  There are substantial problems, and many of the inferences we make about specifics of the past are speculative, but overall, Darwin was not a Madoff, and did not hustle us with a pyramid scheme! 

We'll see how Darwinian concepts, more than any other, enable us to understand why DNA sequence can be 'random' on its own, in the sense that the A,C,G,T's along DNA are by various statistical tests  random: the nucleotides in one place don't predict those nearby or elsewhere along the sequence.  Yet the nucleotides are not just letters in a computer test, and are in fact anything but random.  Indeed, the concept of randomness has to be revised because DNA sequences evolved.

Playing on the real strings, or just your heart strings?

A recent study of whether a combination of professional and amateur violinists preferred old or new violins has gotten a lot of press, here first in the NYT, and then again yesterday.  The study was double-blinded, and 'scientifically run', and claims to be the first to properly test the hype about Stradivariuses.  Touted as 'gotcha' results, showing that people only think Strads are great because they are expensive, the study, published in the Proceedings of the National Academy of Sciences, reported that experts can't tell whether they are playing a priceless Stradivarius or a violin by a modern maker.

We found that (i) the most-preferred violin was new; (ii) the least-preferred was by Stradivari; (iii) there was scant correlation between an instrument's age and monetary value and its perceived quality; and (iv) most players seemed unable to tell whether their most-preferred instrument was new or old. These results present a striking challenge to conventional wisdom.

Here's the NPR treatment, complete with a sound test.

So, the most recent NYT story apparently accepts the comparative study, but it turns out that, according to our daughter Amie who is a professional violinist, by and large the world of professional musician does not.  In fact, one of the participants in the study says here that they were not asked to identify the old violins, they were asked to choose their preference.   She describes her experience:

Upon arriving, I was fitted with modified welders' goggles, and I entered a darkened room. I was then presented with 10 pairs of violins. For each pair, I had a minute to play whatever I wanted on the first violin, then a minute to play whatever I wanted on the second, without switching back and forth. After playing each for one minute, I was asked to choose which of the two I preferred. Then on to the next pair -- 10 times altogether. I thought I was testing 20 violins!

As it turns out, I was testing 6 violins, just paired up differently each time. One always was an old violin, the other was a modern, and they used different combinations against each other.

She points out that the old instruments weren't optimized (sound post adjusted, new strings, etc), while the new instruments were.  

The test was not over after the 20 violins, which were really six violins. After that part of it, the six violins were laid out on the bed, and I was given 20 minutes to play with them as I liked. My task was to choose which of these violins I would take home if I could, and also to decide which of the six was "best" and "worst" in each of four categories: range of tone colors, projection, playability and response.

She preferred one of the moderns, although she did say in her comments for the investigators that she thought it had potential, not that it was already great (good violins improve with time as they are played, although modern violins can either improve, or they can lose their sound, so the reputation of a modern maker is only enhanced if their violins stand the test of time).  That is, this violinist suspected it was a modern violin.  And, she points out that they were not asked whether they could tell the difference, just which they preferred -- despite the inferences all over the web that even professional violinists can't tell old from new, and only like Strads because they are expensive and have a mythic reputation.

Another one of the participants, "an accomplished amateur violinist and violin maker", believes the study was well-run and the results perfectly credible, as he says here.

So, what's going on?  Was this a valid study or wasn't it?  Does it bust the Stradivarius myth?  Some violinists have pointed out that testing instruments in a small hotel room, where their sound can't project, seriously hinders a player's ability to judge.  Others that the researchers'  conclusions weren't properly inferrable from what the players were asked to judge, and of course if that is so, no matter how 'scientifically valid' the study was, the conclusions are largely the researchers' interpretations rather than objective findings.   And, some of the participants were amateurs, and even if they were excellent musicians, their experience with playing in concert halls, where an instrument really makes a difference, is necessarily limited. Of course, musical quality is largely subjective and perhaps knowing the instrument is a Strad can make some people enjoy it more.  And, the impartiality of the researchers, some of them modern instrument makers, might be an issue.

The quality of the sound of a string instrument depends on many variables, not least of which is the listener's preferences.  But also, the bow with which it's played, the adjustment of the sound post, the quality of the strings, and even what kind of strings, what the player chooses to play, and whether it's the same piece on each instrument.  And so forth.  And of course, Strads have been fixed, tuned, adjusted, revarnished, and so on so that today's Strad is not the same as what Stradivarious himself built.

This is not like judging red wine, which can just be poured into a glass, allowed to breathe for a set number of minutes, and then tasted.  Preference for wine is still subjective, but at least the factors that can influence its taste are part of the essence of the wine, unlike the music that comes out of a violin. If fact, it's been shown repeatedly that blindfolded, even experts can't reliably tell if a wine is great or just good, or often, even if it's red or white!

Scientific methods can be applied to a multitude of questions, but the question has to be clear, the variables controlled, and the subjectivity of the answers at a minimum.

PNAS hitting the bell of deep science yet again!  Still, if not the most profound kind of science, mythbusting is important, even if it's not in the interest of vintners or, in the case of violins, of auction houses.  But, should this study be considered the final word?

Hot flash (not hot flashes) of the week: Who stops at red lights?

Well, dear MT readers, we hate to shock your tender sensitivities, but some times we feel absolutely forced to confront you with truths that you may wish were kept hidden.  So here goes:

A new paper by Shutt et al., in Biodemography and Social Biology, reports from a whopping sample of  612 men and 601 women, adolescents or very young adults, who self-reported about their sex-purchasing activity (was this marketing research?), that males pay for hookers much more than females do. We were blown away by this finding, but then even more impressed by the fact that this contemporary US survey of whopping size proved evolutionary theories about sex and parental investment.  Men  can just say screw the consequences (so to speak), while women are left changing the nappies (while the guys are out screwing other consequences).

But then why are the women in the trade, given these evolutionary 'drives'?  Are they all forced, and if so how does that relate to evolution, since part of evolutionary theory is that males want their women to be chaste so they know who's the father of their children?  Or is this a financially viable career option for those who can't get a comparable job in banking (a similarly moral profession)?  Madams themselves are female, and they're doing the organizing. 

Our point is not to question the results of this paper, given their sample and the question they asked.  Rather, it's to question their relating this to more general theory.  Whether or not the behavioral evolutionary theory itself has merit, this seems like a misrepresentation of what we can, and can't, actually say about how evolution really worked as contrasted with how we think it might (should, or even 'must') work, and what kind of data we'd really need to say it. These kinds of data are possibly consistent with that theory, but hardly constitute strong support (or not) of it.  But publication of such speculations, which is routine these days, can give an impression to readers who don't know enough to be skeptical, that we know more than we really do.  The burden for such misrepresentations rests on the scientists and the journals that publish the work.  And when it comes to evolution-based determinism regarding behavior, history clearly proves that can have dangerous societal implications, in which the powers that be decide who's OK and who's not, and what to do (to them) about it.  Are hookers hookers because of their genes?  Are the guys customers because of their genes (that is, the genes that 'make them do it', not those they shed in their business transactions)?  If their genes made 'em do it, is it something 'we' have a right to 'treat'?


Science representing itself as representing something generic and fundamental, should at least have data that are appropriately representative of that principle.  There are many reasons that males and females may have different reasons for stopping, or not stopping, at red lights.

That's disgusting! Make up your own Just-So story about the evolution of an emotion

The evolution of disgust
Everyone seems to be talking about disgust these days, from why it evolved to what parts of our brains light up when we feel it (it's the anterior insular cortex).  There was a story in the NYT about it on Tuesday ("Survival's Ick Factor"), and a review of a new book (one of many) about it in the Sunday NYT Book Review, a conference in Germany, and an issue of the Philosophical Transactions of the Royal Society devoted to the subject.  Darwin included disgust in his list of the 6 basic human emotions, and wrote of seeing it on the faces of his infant children. 

Indeed, it seems that disgust now explains many human characteristics from tribalism, to disease avoidance, to poison critter avoidance, and mate choice.  And, disgust gone haywire explains psychological pathologies from obsessive compulsive disorder to excessive anxiety.

A paper in Perspectives in Biology and Medicine in 2001 lists the basic disgust elicitors. 

We suggest that the objects or events which elicit disgust can be placed in the following five broad categories:

1. Bodily excretions and body parts

2. Decay and spoiled food

3. Particular living creatures

4. Certain categories of "other people"

5. Violations of morality or social norms

Bodily secretions are the most widely reported elicitors of the disgust emotion. Feces appear on all of the lists, while vomit, sweat, spittle, blood, pus, and sexual fluids appear frequently. Body parts, such as nail clippings, cut hair, intestines, and wounds, evoke disgust, as do dead bodies. Certain animals are repeatedly mentioned, in particular pigs, dogs, cats, fish, rats, snakes and worms, lice, cockroaches, maggots, and flies. Spoiled food, especially meat and fish, and other decaying substances, such as rubbish, are disgusting to many respondents. Certain categories of other people are also found disgusting, notably those who are perceived as being either in poor health, of lower social status, contaminated by contact with a disgusting substance, or immoral in their behavior.

And then there are sensory cues, smells, feel, sounds.  A number of writers explain that all these things are disgusting because they remind us of our animal -- unhealthy? -- origins.  Others say it evolved to defend body and soul from pollution (as apparently being reminded of our animal origins pollutes the soul).  

In their exploration of Darwinian medicine, Nesse and Williams (Evolution and Healing, 1995) suggest that an instinctive disgust may motivate the avoidance of feces, vomit, and people who may be contagious, and that disgust is one of the mechanisms crafted by natural selection to help us keep our distance from contagion. Pinker (How the mind works,1998) proposes that disgust is "intuitive microbiology," and that this explains our aversion to objects that have been in contact with disgusting substances: "Since germs are transmissible by contact, it is no surprise that something that touches a yucky substance is itself forever yucky." 

It's nice that this emotion is finally getting the attention that it clearly deserves.

But wait a second!
Except -- there had to be an except! -- except that a lot of this starts to sound suspiciously like just another elaborate evolutionary Just-So story.  New parents, nurses, physicians all quickly lose any disgust at bodily excretions, and one person's spoiled food is another's delicacy.  Just think of the rich array of foods that people on this planet eat.  Not to mention dogs, who'll eat just about anything.  Dogs share many of our emotions, and, if essentially all humans feel disgust, our sense of disgust had to have evolved earlier than we did, so shouldn't other lineages who share our disgust-feeling common ancestor, such as dogs, also share our supposedly instinctual disgust with eating, say, rotten meat, or vomit?

Dead Zambian shrew, not Holly's shrew

Which may explain why Holly reports holding up a dead shrew to her two dogs and finding that they wouldn't touch it.  She says her dogs would happily tear apart a dead squirrel, but not the shrew.  She thinks maybe it died of pesticide poisoning, though she couldn't smell anything.  Were they disgusted (by at least this one thing!), thus saving themselves from pesticide poisoning?  Or is it that they have learned to tear apart squirrels and not shrews?  Who knows?

But then, why is it disgusting to some people to eat insects, while others thrive on them (roasted, chocolate covered, etc.)?  Or why did Americans once disdain disgusting lobster....and now drop big bucks for a nice, juicy claw?  European Americans recoil at the thought of eating horse meat, while to many of their Old World brethren it's a delicacy. Or what about latakia pipe tobacco and lapsong suchong tea, 'cured' as one might say, over dung fires?  The list could go on and on and on, but what it means is that there's an obvious learned component.

But, let's agree for the sake of argument that disgust as an emotional reaction in fact evolved as a specific trait.  And even that disgust might have its uses (though, too much of it can be a problem).  All this means is that, as other successful traits that have stood the test of evolutionary time, disgust itself is adaptable.  That is, yes, we may all feel disgust, but what disgusts us at any given time is culturally determined, not innate.  Otherwise, how could we learn that Twinkies were disgusting?  (Or not.  It turns out that if you search in Google Images for Twinkies, you'll find a photo of Twinkies Fondue; Twinkies, circus peanuts, caramel Ho-Hos, marshmallows, and candied orange slices on a skewer, waiting to be dipped into molten chocolate.  Or Scottish deep-fried Mars bars!  Who thinks these things up?)

Our better idea!
And any of us can think of alternative hypotheses as to what disgust is 'for'.  Here's ours -- how about that it's part of our repertoire of communication, rather than an innate ability to save ourselves from decaying meat?  Why would we need a facial expression that communicates disgust if the emotion itself were the survival tactic, alerting us not to eat that rotting wildebeest?  Surely we could teach our children that even bunny rabbits were disgusting, if we started them young enough.  So, in adaptive terms, it's communicating that we're disgusted that's important, not what we're disgusted by.  Why?  Because it elicits caretaking, a survival tactic if there ever was one. And of course survival is very directly tied to evolutionary fitness.

But all this hoopla about disgust is a bit disgusting itself.  Are we really desperate to have specialties so that someone can be called by the NY Times "a pioneer of modern disgust research"? It's one thing to specialize, even to this extent, and perfectly legitimate to identify 'disgust' and try to understand its neurophysiology and physiological triggers -- if there really is an 'it'.  But it's quite another big step to attempt to Darwinize something so vague, and the fact that Darwin mentioned it doesn't change that.  Evolutionary scenarios are hard to pin down, even with well-defined traits.  The evidence by and large suggests that most of the human versions of this emotion, if it is a particular emotion, are learned and experiential and culture-specific -- adaptable. 

Obviously the inherent aspects, the 'adaptive' aspects of our disgusting behavior are unclear, hard to identify, harder to prove, and in any case it is not obvious that we have any such adaptations that were not in place eons before a human ever stepped on a wildebeest patty (barefoot--UGH!).

Spontaneous combustion! Life is not the same as organized life. Part II.

The idea of spontaneous generation as debated by philosophers before the age of science referred not just to life as a particular kind of self-sustaining chemical reaction, but to that process as manifest in highly organized--differentiated--organisms:  trees, beetles, worms, and all of us.

Maggots--disgusting as they may be--are highly organized forms of life with anatomic structures, highly specialized cells, and that develop by developmental differentiation through sequential patterns of gene expression.  The idea of spontaneous generation referred to such complex creatures, and by extension to all organisms, not just bubbling primal soup.

Even if such soup were to exist today in little cauldrons in the rocks or sea, it would not produce such organisms.  That is the key difference between life as a chemical phenomenon--which it most clearly is--and life as a complex ecology of different organisms, each of which is itself an internal ecology of different organs, which are ecologies of different cell types, and cells have their own internal ecology of subregions, specialized functions, and the like.  This is true even of bacteria, singly and in aggregates, fossils of which have been found from as early as 3.8 billion years ago.  Those don't arise spontaneously!  And that is the very central key to why life is not like crystal formation, volcanoes, and solar systems.  And, of course, it's the deeply insightful awareness of this, by Charles Darwin and at the same time by Alfred Wallace, that we call 'evolution', that was one of the most transforming insights a human being ever had.

Life is about continuation of a reaction--that's, after all, what you are relative to your parents, and their parents, and theirs, and......so on back to the initial lively cauldron.  And more importantly, centrally, life is about the accumulation of divergence of subsets of this reaction.  Divergence requires isolation (we called it partial sequestration in Mermaid's Tale), and transmission with memory (largely resident in DNA) that preserves divergence.  And the way that such divergence with memory accumulates in the kind of life we have here on earth, at least, is brought about by the fact that the basic processes of life are combinatorial and polymeric (see our prior series on this topic).

Genes and the proteins they code for are polymers, long molecules of sequences of a few possible subunits, whose behavior depends on, resides in, and is all about the number, location, and arrangement of particular substrings along the polymer.  That is what accumulates 'information' over time and produces functional subdivision like tissues and organs.

No matter what you may think of maggots (some people actually eat them!), they are marvelously organized, complex forms of life.  New flies are not spontaneously generated; instead, they are just cellular continuations of parent flies.

Any spontaneous generation of new 'living' (biochemical) reactions would simply be simple.  Organization of sequestered substructures and the DNA and protein polymers that make that possible, took hundreds of millions of years, if we can trust the earliest fossil evidence, found by our friend Bill Schopf at UCLA and others.  What we don't allow in modern biological thinking is spontaneous generation of highly organized life.  It must be possible in principle: after all, you and we are just chemical reactions that were generated by the chemical reactions in the eggs that founded us and all the way back to the first soup.  But the probability that a bunch of molecules randomly bouncing around in some puddle in your back yard would generate a bacterial cell, much less a bunny rabbit, is astronomically small (if the universe is truly infinite, however, that must be occurring infinitely many times at this very instant and at every instant--think about that for a while!).

In boring mundane terms, at least, it's not happening here.  Nor are organized structures like, say, bunny ears, being generated out of a tadpole pond.  No, these things are products of very long histories, not short-term instances. 

We need to carry the point forward, because it has fundamental lesson for our view of how evolution works and, generally, is strong support for and reflection of a key point in Darwin's founding theory of evolution.  It's that complex structures arise gradually.  If bunny ears or even just maggots could arise spontaneously, Darwin rightly thought, religious Creationist arguments would be more plausible than historical evolutionary ones.  But the facts show that the evolutionary arguments are the only plausible ones of those that have been offered so far.

Even when complex traits do seem to arise out of nowhere, such as extra vertebrae in the backs of children that were  not present in their parents, this is not spontaneous generation in the usual sense, because these are just anomalous repetitions of processes--like the one that generates vertebrae--that stutter more than usual.

This is why we never find, say, an organ from some dead organism that is totally unlike anything ever seen before.  Nowhere on the tree of the major life-forms that we know of (image grabbed from the Smithsonian Museum's webpage: http://www.mnh.si.edu/exhibits/darwin/treeoflife.html).  Or, less fantastical, we would never unearth a long DNA sequence that was totally unrelated to that of any known type of organism--that could not be shown to fit somewhere in the 'tree' of DNA sequences from plants, animals, and microbes for which we do have sequence.  DNA sequences carry the information for organisms, coding for their traits, and must reflect their history.  

If  we really found a long DNA sequence with no similarity to those we know of, and no structure (such as protein coding elements) that are universal to the life we do know of, we would be in a real quandry: it would be some trick, some product of a  DNA sequencing machine rather than a remnant of actual life, or we would have to rethink our entire theory of the history of life.  It would be very exciting and upsetting--a lot of fun to live through--but there's no sign of it happening.

So this is the deeper sense in which biologists can seriously say that, yes, spontaneous generation did occur once, but no, it is not an explanation for subsequent life.  We're not having our cake and eating it too:  we're saying that a cake takes time to bake!