The Primate Family Tree: A classroom activity in evolution, adaptable for all ages

Feel free to email me to request the document (with all this text and all these figures) which is easier to work with. holly_dunsworth@uri.edu

In this activity, students will…

• Observe and describe the similarities and differences between primates and other familiar mammals, and also the similarities and differences among primates.

• Classify primate species into groups (superfamily and above). 

• Transform Linnaean classification into evolutionary theory by merely changing the question from How do primates look similar and different from one another? to Why do primates look similar and different from one another?

• Build a primate “family” tree by turning Linnaean classification into phylogeny (or evolutionary tree-thinking) to describe how common ancestry and change over time explain both similarities and differences among primates.

How old are the students? 

5-105* 

*Prior to about age 8, teachers will need to riff quite creatively off track from this (for one, because reading the Primate Taxonomy Table may be very difficult for younger students), but I include those earlier ages because I believe that teachers of those age groups can find a way to use this lesson if they’d like to. It's possible that just knowing how to read is enough to do a stripped down version of this activity, which includes children even younger than 5. I have used this activity successfully with students aged 8-25. For upper-level anthropology courses I've used it as an ice-breaker to kick off the semester (with students who have a background in evolutionary thinking already).

How long will it take? 

30 minutes minimum (much more depending on detail you wish to cover)

What materials?

• Color pictures of a diverse array of primates - approximately 3-5 times as many pictures as students. Too many is better than too few. Rip them out of old textbooks and laminate for durability. Print them off the Internet (arkive.org is one of the best sources) and laminate for durability. Make sure to have at least two different pictures of the same species for many of the species you include. Label most of them with the common names under “examples” on the chart for Part 2 (e.g. “baboon”). But a fraction may be only labeled with geographic region, scientific name, or nothing at all.  Explanation is in the instructions below. Specific sources of primate photos for printing are listed in Appendix A.

• Pencil – 1 per student

• Note cards -  1 per student (for them to draw a self-portrait or a symbol to represent themselves)

• Poster paper, or large sheets of paper – 6, one for each superfamily on the Primate Taxonomy Table (below)

• Tacky gum, reusable tape, or some other ingenious sticky tool that can both hold primate pictures to the posters and also be removed and moved to different posters when students change their minds. 

• Handout for students (see options below; must at minimum include Part 2: Primate Taxonomy Table)

 

Teacher Instructions

Part 1. (3 MINUTES minimum) DISCUSS CLASSIFICATION

Using the resources under Part 1 of the materials below, hold a discussion about classification. Don’t talk about relatedness or common ancestry! And especially don’t talk about evolution! (Next, in Part 2, the taxonomic terminology they will use, like “family,” will encourage them to think evolutionarily, hopefully, and this will come into play later in the activity.)  They will already be familiar with how like is grouped with like—I often use sock and underwear drawer analogy, grocery store organization works too. Stick to primates if you’d like, but if you go broader, make sure to end your discussion with primates, including humans. Make sure to explain how (Linnaean) taxonomy/classification works. That is, simply/broadly (or complicated/specifically if you’d like) describe the methods—the use of comparative anatomy and homology and also the binomial species name for the smallest, most exclusive group within ever-more inclusive groups going up to the Kingdom level.

Part 2. (10 MINUTES minimum) CLASSIFY THE PRIMATES INTO SUPERFAMILIES

Hang a poster for each superfamily along the wall in no particular order, lay out a pile of the photos in no particular order. Students get up out of their chairs, and using the Primate Taxonomy Table (below) they stick each primate picture to a poster labeled with the superfamily to which they think it belongs. They are able to do this without any knowledge of primates because you have labeled most of the pictures with “baboon”, for example. They can go to the table on the handout and see that baboons belong in the superfamily “cercopithecoidea” and stick the photo to that poster. Unlabeled baboons should look similar to labeled ones and they should also be sticking those to the cercopithecoidea poster if they are carefully observing and are engaged in the activity. Make sure they stick their own “human” cards to a poster too.  Hopefully they will respectfully work together and move others’ around if they think they have a better case for a different classification of a particular primate.  

Primate Taxonomy Table (handout).
Email me for a file you can work with more easily (holly_dunsworth@uri.edu)

Part 3. (5 MINUTES minimum) STUDENTS SHARE THEIR REASONING FOR THEIR CLASSIFICATION

Lead the students through a tour of the features that unite the primates into each of the superfamilies. First ask them to describe the similarities among all the primate superfamilies (a quick review of Part 1). Then ask them to describe the differences they can see between the superfamilies: what makes hominoids separate from cercopithecoids, etc?  It’s not imperative, but I recommend starting with the primates that share the most with humans (hominoidea) then going to the cercopithecoidea, and so on. This may appear to be difficult because they may observe overall (super) family resemblance but not be able to describe any more detail than that, which is fine! Using the resources under Part 3 below, you can provide details of the differences between the superfamilies, both that are visible in the pictures and that are not. 

Part 4. (2 MINUTES minimum) CHANGE THE QUESTION FROM HOW DO PRIMATES VARY? TO WHY DO PRIMATES VARY? 

Challenge students to explain the patterns of similarities that make all these creatures primates and that, for example, unite the hominoids, the cercopithecoids, etc..., while also explaining the differences that make each species unique and each superfamily unique.  Hopefully, with very little help from you, they will arrive at the idea that relatedness explains it. Family history, on a larger scale than our own families, but the same kind of thing. Common ancestry and change over time since common ancestors. Evolution plain and simple.  

Part 5. (10 MINUTES minimum) BUILD A PRIMATE TREE and DISCUSS ITS MEANING. 

There are many ways to do this and showing more than one way would be great, but one way is to put the known phylogenetic structure, the branches of the tree for the superfamilies (see resources below) on the wall or board and have them deduce where the superfamilies go and stick the posters to those branches. Another way, for older students, is to have them figure out the relatedness of superfamilies first, starting with humans and hominoids and hypothesizing which are more and more distantly related based on increasing differences. Another is to merely show them how to walk through the table for Part 2, and change it into a hypothesis for phylogenetic/evolutionary history, with lineages diverging where each level of taxonomy divides things further into more exclusive groups. So show them how to draw time and descent lines around that evolution-free taxonomy (classification table for Part 2) that they already have and they’ll arrive at.. dun-dun-DUN evolution! I prefer to draw the students’ hypothesized tree like a big oak tree (with a streps/haplorhine split in the trunk deep down near the bottom) on the wall, and to stick the posters at the ends of the branches. But it’s obviously up to teachers and whether they have a big wall to draw on! I cover my wall in paper first so that I can draw the big tree. 

Teacher Resources and Optional Handout Materials

Teachers: Pick and choose what you’d like to include in your handout, depending on what you will cover with your particular students (depending on age, time, goals, etc…). Be careful not to share any handouts too soon and spoil the opportunity for students to think first, if that’s what you have time for and are going for. 

Part 1

• Where do humans fit in the classification of life on Earth? (link)
• How do we make these categories? We ask, ‘What’s similar” of the anatomy, when comparing different species.  That is we look to homologous structures.  A great example is the tetrapod forelimb. (link)

• What makes a primate a primate? (link)

Part 2

Lemuroidea

Nose: wet (hence the name strepsirrhine)

Geographic region: Madagascar

Tail present: yes

Activity: Some nocturnal, some diurnal

Teeth: Many more than we have, some shaped like comb for grooming fur

Body size: Small but variable from the smallest primate alive (<< 1 lb.) to ones as big as big pet cats (20 lbs.)

Lorisoidea

Nose: wet (hence the name strepsirrhine)

Geographic region: Sub-Saharan Africa and Southeast Asia

Tail present: yes and no

Activity: nocturnal

Teeth: Many more than we have

Body size: small

Tarsioidea

Nose: dry (hence the name haplorhine) 

Geographic region: Southeast Asia

Tail present: yes

Activity: nocturnal

Teeth: Many more than we have

Body size: small

Ceboidea

Nose: dry (hence the name haplorhine) 

Nostrils: flat and facing out to the side (hence the name platyrrhine)

Geographic region: Central and South America

Tail present: yes (and some are even prehensile!)

Activity: Most diurnal, some nocturnal

Teeth: four more than humans (one extra premolar/bicuspid in each quadrant of mouth compared to us)

Body size: Variable, with some small (like pygmy marmosets) but the largest, the spider monkey, is 25 lbs.

Cercopithecoidea

Nose: dry (hence the name haplorhine) 

Nostrils: facing down (hence the name catarrhine)

Geographic region: Asia, Southeast Asia, and Africa (all sub-Saharan except the Barbary macaque of Morocco and Gibraltar)

Tail present: yes (but 2-3 species are no or have very small stubs)

Activity: diurnal

Teeth: same number as humans

Body size: Many, including most macaques and baboons, weigh more than any ceboids. Some mandrills weigh over 100 lbs.!

Hominoidea

Nose: dry (hence the name haplorhine) 

Nostrils: facing down (hence the name catarrhine)

Geographic region: Southeast Asia (gibbons, siamangs, orangutans); Sub-Saharan Africa (gorillas, chimpanzees, bonobos); Worldwide (humans)

Tail present:  no

Activity: diurnal

Teeth: same number as humans

Body size: Although gibbons and siamangs are the smallest of the group, this group is the largest in body size and weight of all primate superfamilies and includes gorillas, the largest of all primates which can weigh 400 lbs.!

Part 4

Evolution and phylogenetic thinking is just family history writ large.

Part 5. The Primate Family Tree

Here is an example (one hypothesis, if you will) of a primate phylogeny or phylogenetic tree or evolutionary tree. 

Here's guidance on how to turn Part 2’s table into a phylogeny with students.

Then here it is, stripped down and rotated...

Appendix A.

Sources for primate pictures

Lemuroidea

Dwarf lemurs: http://www.arkive.org/explore/images?q=Dwarf%20lemurs

Mouse lemurs: http://www.arkive.org/explore/images?q=Mouse%20lemurs

Aye-ayes: http://www.arkive.org/explore/images?q=Aye-ayes

Indris: http://www.arkive.org/explore/images?q=Indris

Sifakas: http://www.arkive.org/explore/images?q=Sifakas

Lemurs: http://www.arkive.org/explore/images?q=Lemurs

Sportive lemurs: http://www.arkive.org/explore/images?q=Sportive%20lemurs

Lorisoidea

Galagos: http://www.arkive.org/explore/images?q=Galagos

Lorises: http://www.arkive.org/explore/images?q=Lorises

Pottos: http://www.arkive.org/explore/images?q=Pottos

Tarsioidea

Tarsiers: http://www.arkive.org/explore/species?q=tarsier

Ceboidea

Howler monkeys: http://www.arkive.org/explore/images?q=Howler%20monkeys

Spider monkeys: http://www.arkive.org/explore/images?q=spider%20monkey

Owl monkeys (night monkeys): http://www.arkive.org/explore/images?q=Owl%20monkeys%20night

Marmosets: http://www.arkive.org/explore/images?q=Marmosets

Tamarins: http://www.arkive.org/explore/images?q=Tamarins

Capuchins: http://www.arkive.org/explore/images?q=Capuchins

Squirrel monkeys: http://www.arkive.org/explore/images?q=Squirrel%20monkeys

Titi monkeys: http://www.arkive.org/explore/images?q=Titi%20monkeys

Sakis: http://www.arkive.org/explore/images?q=Sakis

Uakaris: http://www.arkive.org/explore/images?q=Uakaris

Cercopithecoidea

Baboons: http://www.arkive.org/explore/images?q=Baboons

Macaques: http://www.arkive.org/explore/images?q=Macaques

Vervets: http://www.arkive.org/explore/images?q=Vervets

Guenons: http://www.arkive.org/explore/images?q=Guenon

Colobus: http://www.arkive.org/explore/images?q=Colobus

Langurs: http://www.arkive.org/explore/images?q=Langurs

Proboscis: http://www.arkive.org/explore/images?q=proboscis%20monkey

Drills and mandrills: http://www.arkive.org/explore/images?q=drill%20mandrill

Hominoidea

Gibbons: http://www.arkive.org/explore/images?q=Gibbons

Siamangs: http://www.arkive.org/explore/images?q=Siamangs

Orangutans: http://www.arkive.org/explore/images?q=Orangutans

Humans: students draw a personal sign, symbol, or self-portrait

Chimpanzees: http://www.arkive.org/explore/images?q=Chimpanzees

Bonobos: http://www.arkive.org/explore/images?q=bonobo

Gorillas: http://www.arkive.org/explore/images?q=Gorillas

Triumph of the Darwinian Method, continued: genetics as history

Is a DNA sequence 'random'?  How would one know?  There are several tests for randomness that one can do on a DNA sequence, however it was derived -- there's a discussion of this issue here. For example, one can go down the sequence one nucleotide at a time and ask if that nucleotide can predict the next one in line.  One way is to ask whether the next ones are A, C, G, and T each 25% of the time.  That would mean that whatever the current nucleotide is, the next one is just unpredictable.  Then one can ask the same for the nucleotide 2, 4, ..., etc 12,287 positions down the row.  With some exceptions, such tests for predictability or periodicity would fail.  That means, the sequence is random!

That is very weird, since DNA is responsible for organisms, and organisms seem to be anything but random!  Or, could it be that at some higher level, organisms in this earth are, in some profound ways, 'random' in structure or behavior etc.?

If I give you a DNA sequence, and you go into some program on the web (of which there are many) that searches all known DNA sequences to see which are closest to the test sequence, the expectation is that it will be an exact or near match to something known.  We have DNA sequence data from most branches of life, so we'd 'hit' a known species, or something similar in sequence.  That would pin our test sequence on the tree of relationships which to a Darwinian is a tree of life, and the key aspect of that is that the tree is the result of a history.

If this seems obvious, it is at the same time a profound reflection of the only convincing hypothesis about life, and here our method assumes a 'tree' and fits a sequence on it, and the only reason we can do this is because life is history.  If the sequence were from an individual already sequenced, there would be a complete match.  If it were from that individual's sibling, there would be a very close match.  If from the same population within a species, the similarity would be less but still very strong.  If from a different but 'related' species (say, two different forms of cat) again similarities would be clear--way more than with a bird or lizard or maple sequence.  This is only because of history, and it is only that fact that allows us to make sense of DNA similarities.

Suppose you were given the following sequence:

ACGTCCAATCTGGGGTAAACCCGAGATCTGAGGCCTACCTGCAATTTCGGCCACACACAGGGTGTTACCCCGACTTCAGGGCA

Now, go search the data bases for it, to see what known sequence it's closest to.  Here is what you'll find if you use a common tool, called BLAST, for comparing sequences: "No significant similarity found."

Now, since we have sequence from basically every branch of life (though, at present, not whole genome sequence, to be sure, but this is a practical but not conceptual problem in our current context), how can our test sequence not fit the tree?  If it really were unrelated to anything known, nor within the tree of known sequence, we would either have a sequence totally made up (which this one was!), or from a wholly unknown branch of life.  We have so much data at present, that such a result would be very spooky and unlikely.  Mutations arise randomly in DNA, relative to their effect on the organism, but even this kind of randomness is inherited, which is why even sequences that, by various statistical tests, seem to be random assemblages of nucleotides, fall into historical relationships with each other.  They may be 'random' on their own, but not to each other.

A sequence truly unrelated to any other could deeply threaten our very Darwinian foundations!  That is how strong and well-supported his hypothesis about life is.  If that is a failure of induction, then so be it.  We would go to very great lengths to find other explanations for our mysterious sequence, before we would even begin to question the hypothesis of evolution!  Would it be less weird than current allegations of meteorite structures, to suggest that such a sequence came from Mars?  Would it resuscitate arguments about spontaneous generation (see earlier post on this)?

And in another way such a sequence would be at least as profound, or perhaps much more profound than just a missing relationship.  That is because, on its own DNA sequence can seem, statistically,  to be a random string of nucleotides--once we know about history, and have experimental data (which we do, in profusion) we can see how utterly nonrandom DNA sequences are when it comes to what they do--that cannot by itself be 'read' off from the sequence alone, without this information.  And this information is essentially connected to Darwinian ideas.

This gets us to consider not just the fact of the tree of life's history, but the functional roles of DNA, and Darwin's other idea, that the tree is built by natural selection.  Comparative DNA sequences, viewed through the Darwinian method, also say something about that as well.  That is for next time in this series....

On our title

We chose our title, The Mermaid’s Tale, because we like that it can be thought of as having two meanings. First, of course, it refers to the bodily arrangement of mermaids, but second, it allows us to tell the story of how biological traits, and the creatures that carry them, develop in the short term and what this means on the long term evolutionary time scale. Even religious fundamentalists, who would say they don’t accept the basic principles of evolution, know that there is no such thing as a mermaid. Ironically enough, the reason we, and they, can be so sure is because of the principles of evolution. (Image is an oil painting by John Waterhouse, 1909, now in the public domain.)

The mermaid’s body is said to be made of sections (torso and tail) that are stapled together from different parts of life’s phylogeny, often called the Tree of Life. The ‘Tree of Life’ is a representation of the relationships among organisms: species, like different kinds of cats or goldfish, are placed close together on this diagrammatic representation, because they share a more recent ancestor than other species. Fish and oak trees are very far apart, because they haven’t shared a common ancestor since far into the distant past. But members of similar species often have very similar biology, such as their basic body plan and structures.

The mermaid seems on the surface to be a perfectly plausible species. But it isn’t so. Her parts can’t be found on the same creature because they arose and evolved on lineages, branches on the Tree of Life, that separated from a common ancestor hundreds of millions of years ago. The genetic mechanisms that assemble organisms as they develop have a history that is characterized by sequestration, or isolation – a general principle of life in all its dimensions. In this case, the isolation in different species led to differences in the details of the embryological development of fish with scaly tails but no legs, and of mammals with legs, breasts, and fur, that accumulated over those hundreds of millions of years since they diverged from their common ancestor. The fish tail and the mammal torso now are each built by developmental processes specific to each lineage, each step in development contingent upon what came before – another general principle of life. The processes that build similar traits among closely related species within each lineage are similar as well. Because of contingency, and ‘inheritance with memory’, another basic principle referring to the processes that make offspring resemble their parents and species within lineages resemble each other, although both fish and mammals share many important traits – like having a backbone – they don’t, and can’t have the two basically different body halves that a mermaid does.

Interestingly, however, it was discovered not so many years ago to great surprise, fish and mammals, torsos and scaly finned tails, despite their deep separation in evolutionary time, do share many aspects of the basic processes of development, even while differing in the specifics. The way many of the same genes and genetic mechanisms are used are quite similar in both lineages. Indeed, we share some of this with insects and worms, and we share many of the same basic types of mechanism even with plants – though the vast majority of the specific genes used in those mechanisms are totally different. This is an important aspect of the discussions we hope to hold on this site.

Darwin’s basic insight about the unity of life, descended from a common ancestor, has been confirmed many times over by the lessons of genetics and developmental biology. There’s something deeply satisfying about that.