<?xml version='1.0' encoding='UTF-8'?><?xml-stylesheet href="http://www.blogger.com/styles/atom.css" type="text/css"?><feed xmlns='http://www.w3.org/2005/Atom' xmlns:openSearch='http://a9.com/-/spec/opensearchrss/1.0/' xmlns:georss='http://www.georss.org/georss' xmlns:gd='http://schemas.google.com/g/2005' xmlns:thr='http://purl.org/syndication/thread/1.0'><id>tag:blogger.com,1999:blog-1812431336777691886</id><updated>2012-02-02T17:19:32.974-05:00</updated><category term='Human Heredity'/><category term='The expression of the Emotions in Man and Animals'/><category term='gene &apos;for&apos;'/><category term='meteorology'/><category term='reductionist science'/><category term='Ig Nobel Prize'/><category term='hypertension'/><category term='evolutionary economics'/><category term='infection'/><category term='genetic code'/><category term='Charles Spence'/><category term='GM foods'/><category term='quorum sensing'/><category term='nature'/><category term='aliens'/><category term='arsenic'/><category term='atavistic traits'/><category term='uncertainty'/><category term='recreational genomics'/><category term='paradigm shift'/><category term='skin color'/><category term='Tinbergen'/><category term='sustainability'/><category term='academia'/><category term='Cambrian Explosion'/><category term='decline effect'/><category term='polymers'/><category term='lab-on-a-chip'/><category term='evolution and culture'/><category term='type 2 diabetes'/><category term='eureka'/><category term='Baur Fischer and Lenz'/><category term='academic life'/><category term='In Our Time'/><category term='Red Queen hypothesis'/><category term='pedophilia'/><category term='CF'/><category term='cognition'/><category term='probability'/><category term='linkage studies'/><category term='fraud'/><category term='genetic isolates'/><category term='science education'/><category term='TH Morgan'/><category term='human malaria'/><category term='ClimageGate'/><category term='selfishness'/><category term='isolation by distance'/><category term='hippocampus minor'/><category term='homoplasy'/><category term='Dengue fever'/><category term='gene expression'/><category term='recessive'/><category term='immunity genes'/><category term='Francis Bacon'/><category term='evolutionary stasis'/><category term='RNA interference'/><category term='sexual behavior'/><category term='Tim White'/><category term='alternative medicine'/><category term='The Myth of Alzheimer&apos;s'/><category term='good science'/><category term='speciation genes'/><category term='meat consumption'/><category term='Thomas Malthus'/><category term='Neandertal genome'/><category term='nature/nurture'/><category term='stromatolites'/><category term='Carnival of Evolution'/><category term='masturbation'/><category term='drinking risk'/><category term='Havasupai'/><category term='child sexual abuse'/><category term='Vladimir Nabokov'/><category term='Darwinian determinism'/><category term='biofeedback'/><category term='laws of nature'/><category term='clinical trials'/><category term='DNA sequence'/><category term='Gary Larson'/><category term='mayhem'/><category term='genes &apos;for&apos;'/><category term='vitamin D'/><category term='cytomegalovirus'/><category term='basic science'/><category term='Ardipithecus ramidus'/><category term='confounders'/><category term='cancer research'/><category term='environmental change'/><category term='T.wrecks'/><category term='cooking'/><category term='homeopathy'/><category term='Dictyostelium discoideum'/><category term='-omics'/><category term='Beat Takeshi'/><category term='nasa'/><category term='gene interactions'/><category term='reaction-diffusion systems'/><category term='genetic determinism'/><category term='darwinian evolution'/><category term='Two Cultures'/><category term='survival of the fittest'/><category term='DSM-V'/><category term='Robert Richards'/><category term='Harry Potter'/><category term='tunneling'/><category term='skeptics'/><category term='T.rex'/><category term='Moon'/><category term='sediba'/><category term='popular science'/><category term='accidental progress'/><category term='Thomas Hardy'/><category term='water-cures'/><category term='Alzheimer&apos;s'/><category term='carnivory'/><category term='e coli'/><category term='complex trait genetics'/><category term='grumps'/><category term='genes for'/><category term='genetic plasticity'/><category term='Yohannes Haile-Sellasie'/><category term='NIH'/><category term='Owen'/><category term='genetic perceptions'/><category term='four humours'/><category term='tang'/><category term='cavities'/><category term='paleontology'/><category term='social darwinism'/><category term='cookies'/><category term='counting'/><category term='osteopathy'/><category term='Lyonization'/><category term='Thierry Addate'/><category term='health education'/><category term='holiday wishes'/><category term='David Brooks'/><category term='X-inactivation'/><category term='stone tools'/><category term='penetrance'/><category term='modern science'/><category term='Institute of Medicine report'/><category term='Atheism'/><category term='African Americans and heart disease'/><category term='genotype'/><category term='funding system'/><category term='Archbishop Tutu'/><category term='behavior'/><category term='skepticism'/><category term='Risch'/><category term='selective pressure'/><category term='dependency ratio'/><category term='mental illness'/><category term='Neandertal'/><category term='phylogenetics'/><category term='health'/><category term='definition of science'/><category term='genes'/><category term='biomedical research'/><category term='BBC'/><category term='risk estimation'/><category term='neglected diseases'/><category term='ecological fallacy'/><category term='twin studies'/><category term='olfactory receptor'/><category term='causality'/><category term='odors'/><category term='sex ratio'/><category term='recombination'/><category term='ecosystems'/><category term='experimental design'/><category term='criminality'/><category term='placebo effect'/><category term='The Land Institute'/><category term='legal definitions of race'/><category term='polygenes'/><category term='large eyes'/><category term='odds ratios'/><category term='James Randi'/><category term='demyelination'/><category term='breast cancer'/><category term='diets'/><category term='carrots'/><category term='self-promoting science'/><category term='behavioral evolution'/><category term='viral load'/><category term='science careers'/><category term='DTC genetic testing'/><category term='cooperation'/><category term='diseases'/><category term='public health'/><category term='Thomas Kuhn'/><category term='underdeterminism'/><category term='instinct'/><category term='Ardipithecus'/><category term='incomplete penetrance'/><category term='climate change'/><category term='Tuskegee'/><category term='etics'/><category term='insect behavior'/><category term='Egyptian mummy'/><category term='evolution of emotions'/><category term='Big Pharma'/><category term='paranthropus'/><category term='Drosophila'/><category term='Gilbert Gottlieb'/><category term='Tornados'/><category term='missing heritability'/><category term='regulation'/><category term='Genetic causation'/><category term='recessiveness'/><category term='radiation-induced cancer'/><category term='selective migration'/><category term='sequencing technology'/><category term='snails'/><category term='vaccine development'/><category term='dietary advice'/><category term='errors'/><category term='hacked emails'/><category term='junk food'/><category term='reproductive compensation'/><category term='evolution of language'/><category term='James Crow'/><category term='differentiation'/><category term='smell'/><category term='diet and exercise'/><category term='microbiome'/><category term='Philosophasters'/><category term='cavemen'/><category term='reversal of evolution'/><category term='Malvern'/><category term='complex'/><category term='vegetarians'/><category term='critical thinking'/><category term='religion and science'/><category term='admixture'/><category term='life cycle'/><category term='genetic prediction'/><category term='objectivity'/><category term='Herbert Spencer'/><category term='African diversity'/><category term='disease prevention'/><category term='environmentalism'/><category term='Lynn Margulis'/><category term='peer review'/><category term='Wallace'/><category term='Carl Zimmer'/><category term='auto-pilot science'/><category term='antiobiotic resistance'/><category term='geologic time'/><category term='bunkum'/><category term='Adam'/><category term='assumptions'/><category term='mitochondria'/><category term='bioethics'/><category term='empathy'/><category term='agriculture'/><category term='surface receptors'/><category term='direct-to-consumer genetic testing'/><category term='parables'/><category term='curiosity-driven research'/><category term='Copenhagen'/><category term='fossil squid'/><category term='plasmids'/><category term='William James'/><category term='chimpanzees'/><category term='variation'/><category term='cellular repair'/><category term='epigenetics'/><category term='mating patterns'/><category term='gene regulation'/><category term='Great Man theory'/><category term='human population history'/><category term='colony collapse disorder'/><category term='brain cancer'/><category term='Empiricism'/><category term='aspirin'/><category term='classical Darwinism'/><category term='Thomas Mann'/><category term='ethics'/><category term='Modernism'/><category term='prostate cancer'/><category term='The Fierce People'/><category term='single-gene disorders'/><category term='ruminant stomach'/><category term='accountability'/><category term='convergence'/><category term='self'/><category term='Human Genome Project'/><category term='telomeres'/><category term='Joe Paterno'/><category term='gorillas'/><category term='signaling'/><category term='inheritance'/><category term='Jon Stewart'/><category term='Francis Collins'/><category term='neural development'/><category term='faith-based science'/><category term='environmental movement'/><category term='bipolar'/><category term='Amy Bishop'/><category term='mammography'/><category term='antiviral agent'/><category term='humanness'/><category term='stupid science experiments'/><category term='stem cells'/><category term='John Wyclif'/><category term='Henrietta Lacks'/><category term='testosterone'/><category term='folic acid'/><category term='Darwin'/><category term='brains'/><category term='Emile Zola'/><category term='genetics'/><category term='behavioral genetics'/><category term='devolution'/><category term='global warming'/><category term='Dawkins'/><category term='paleoanthropology'/><category term='brain'/><category term='polypill'/><category term='whole genome duplication'/><category term='the Englightenment'/><category term='The Mermaid&apos;s Tale'/><category term='Sidereus Nuncas'/><category term='normal behavior'/><category term='permafrost'/><category term='hybrid sterility'/><category term='Roundup'/><category term='aggregate'/><category term='Utah'/><category term='pain'/><category term='muscle weakness from cola'/><category term='John Hawks'/><category term='crickets'/><category term='CT scan'/><category term='arsenic bacteria'/><category term='NCDs'/><category term='pregnancy'/><category term='natural selection'/><category term='education'/><category term='endocannabinoids'/><category term='Gliese 581'/><category term='scavenging'/><category term='biofilm'/><category term='tobacco'/><category term='bad science'/><category term='christmas'/><category term='reductionism'/><category term='forward simulation'/><category term='London'/><category term='risk'/><category term='advocacy'/><category term='AIDS'/><category term='lifestyle'/><category term='accepted wisdom'/><category term='falsification'/><category term='big money science'/><category term='decay'/><category term='Yanomami'/><category term='developmental patterning'/><category term='tooth'/><category term='evo-devo'/><category term='proteins'/><category term='Genesis'/><category term='darwinian fundamentalism'/><category term='causation'/><category term='volatiles'/><category term='heritability'/><category term='astronauts'/><category term='Malthus'/><category term='transitional forms'/><category term='Holiday greetings'/><category term='news hype'/><category term='research funding'/><category term='knowledge'/><category term='lung cancer'/><category term='fundamentalism'/><category term='deism'/><category term='cancer prevention'/><category term='vaccination'/><category term='runner&apos;s high'/><category term='gene'/><category term='human uniqueness'/><category term='anti-intellectualism'/><category term='United Nations'/><category term='Robert Wright'/><category term='Graham Spanier'/><category term='somatic mutation theory'/><category term='descent with modification'/><category term='mutation'/><category term='season&apos;s greetings'/><category term='doubt and dogmatism in science'/><category term='Gina Kolata'/><category term='Haeckel'/><category term='p-values'/><category term='meta analysis'/><category term='smoking'/><category term='scientific theories'/><category term='chickens'/><category term='chance'/><category term='C.P. Snow'/><category term='herbivores'/><category term='herring gull study'/><category term='fitness'/><category term='lysenkoism'/><category term='evolutionary reocnstructions'/><category term='cancer'/><category term='missing links'/><category term='scientific revolutions'/><category term='evolutionary ecology'/><category term='alleles'/><category term='fish'/><category term='San Bushmen'/><category term='mass extinction'/><category term='The Magic Mountain'/><category term='Yanomami blood samples'/><category term='sexual abuse'/><category term='infectious disease'/><category term='maturity onset diabetes of the young'/><category term='Science magazine'/><category term='astrology'/><category term='phenotypic plasticity'/><category term='Polymeadows Farm'/><category term='evolutionary genetics'/><category term='Highgate Cemetery'/><category term='Gerta Keller'/><category term='irreproducible results'/><category term='intelligence'/><category term='Homo erectus'/><category term='gene therapy'/><category term='mtDNA'/><category term='vested interests'/><category term='copy number variation'/><category term='scientific dogma'/><category term='genomewide association studies'/><category term='blogs'/><category term='ENCODE'/><category term='post-Englightenment'/><category term='ASD'/><category term='taxonomy'/><category term='&apos;junk DNA&apos;'/><category term='anthropology'/><category term='evoluition of development'/><category term='SETI'/><category term='ice hockey'/><category term='spiderman'/><category term='dogs'/><category term='IPSO'/><category term='hypothesis testing'/><category term='biobanks'/><category term='science and belief'/><category term='determinism'/><category term='Santa Fe Institute'/><category term='computer metaphor'/><category term='Descent of Man'/><category term='movie'/><category term='Silent Spring'/><category term='favored'/><category term='Sander Gliboff'/><category term='deductive reasoning'/><category term='Merikangas'/><category term='observational epidemiology'/><category term='BPA'/><category term='neuroscience'/><category term='Daniel Tammet'/><category term='egg cell regeneration'/><category term='Quixotic Trait Loci'/><category term='horizontal transfer'/><category term='mitochrondrial defects'/><category term='Enlightenment'/><category term='Multiverse'/><category term='non-communicable diseases'/><category term='chronic fatigue syndrome'/><category term='monkeys'/><category term='Eve'/><category term='personalized medicine'/><category term='allele'/><category term='William Godwin'/><category term='dildos'/><category term='single gene disorders'/><category term='environment'/><category term='diabetes prevention'/><category term='exposomics'/><category term='Ida'/><category term='zodiac'/><category term='earthquake'/><category term='competing risks'/><category term='scientific merit'/><category term='hominid'/><category term='age at menarche'/><category term='developmental genetics'/><category term='human evolution'/><category term='risk-benefit analysis'/><category term='olfaction'/><category term='influenza'/><category term='height'/><category term='tool use'/><category term='Alan Turing'/><category term='confidentiality'/><category term='Dred Scott'/><category term='epistasis'/><category term='hype'/><category term='science'/><category term='dinosaurs'/><category term='spiders'/><category term='culture wars'/><category term='research'/><category term='acorns'/><category term='disease genetics'/><category term='biological systems'/><category term='H.G. Bronn'/><category term='politics'/><category term='We are Penn State'/><category term='George Church'/><category term='universities'/><category term='Dollo&apos;s law'/><category term='mapping'/><category term='Richard Dawkins'/><category term='context'/><category term='X chromosomes'/><category term='mice'/><category term='New Yorker'/><category term='remyelination'/><category term='CMV'/><category term='mammograms'/><category term='Darwinian medicine'/><category term='armadillos'/><category term='Owen Bennett-Jones'/><category term='European oil beetle'/><category term='scientific method'/><category term='chronic disease'/><category term='progress'/><category term='GenePaint'/><category term='F508del'/><category term='scientific theory'/><category term='medicine'/><category term='RNAi'/><category term='Mendelian randomization'/><category term='ACLU'/><category term='pervasive transcription'/><category term='risk factors'/><category term='competing causes'/><category term='Mendelian traits'/><category term='privacy'/><category term='running amok'/><category term='Calgary'/><category term='ants'/><category term='human magnetoreception'/><category term='intelligent design'/><category term='single gene disorder'/><category term='statistical significance'/><category term='caffeine'/><category term='Lucy'/><category term='On The Road'/><category term='paleoecology'/><category term='acetaminophen'/><category term='vegetarian diet'/><category term='dominant'/><category term='gene pathway'/><category term='Cell'/><category term='movie review'/><category term='Monsanto'/><category term='environmental factors'/><category term='vegans'/><category term='EvoDevo'/><category term='corvids'/><category term='American Heart Association'/><category term='baseball'/><category term='disgust'/><category term='endorphins'/><category term='heterogeneity'/><category term='nun study'/><category term='DNA'/><category term='Mendelian inheritance'/><category term='penis'/><category term='honey bees'/><category term='Nbr1'/><category term='DRD4'/><category term='systematics'/><category term='pap smears'/><category term='teflon'/><category term='health records'/><category term='asthma'/><category term='squid'/><category term='Entertainment Science'/><category term='epistemology'/><category term='amber'/><category term='grant system'/><category term='New Atheists'/><category term='methylation'/><category term='innovation'/><category term='journalists'/><category term='human exceptionalism'/><category term='epidemiology'/><category term='taphonomy'/><category term='statistics'/><category term='ETI'/><category term='IOM panel'/><category term='microbiota'/><category term='correlation'/><category term='plant immunity'/><category term='Steven Pinker'/><category term='space'/><category term='maternal effects'/><category term='RA Fisher'/><category term='technology'/><category term='teeth'/><category term='poem'/><category term='religious belief'/><category term='futurology'/><category term='DDT'/><category term='retirement'/><category term='irreducible complexity'/><category term='lifespan'/><category term='methanogens'/><category term='Mina Bissell'/><category term='glyphosate'/><category term='TOFT'/><category term='Neanderthal'/><category term='brain plasticity'/><category term='germ theory'/><category term='Negative capability'/><category term='Adam Sedgwick'/><category term='slime mold'/><category term='hybrids'/><category term='speciation'/><category term='cause of HIV/AIDS'/><category term='non-coding regions'/><category term='microbes'/><category term='common ancestor'/><category term='Penn State'/><category term='SMT'/><category term='Dude'/><category term='snake oil'/><category term='religion and mortality'/><category term='longevity'/><category term='Hemophilia B'/><category term='phenogenetic equivalence'/><category term='small risk'/><category term='gene pools'/><category term='Marcus Aurelius'/><category term='aquatic ape'/><category term='the nature of Nature'/><category term='Allen Orr'/><category term='Retraction Watch'/><category term='phrenology'/><category term='synaesthesia'/><category term='re-evolution'/><category term='modern synthesis'/><category term='Al Knudson'/><category term='female orgasm'/><category term='heresy'/><category term='CFTR'/><category term='bad breath'/><category term='Matthea Harvey'/><category term='common descent'/><category term='big science'/><category term='evolutionary biology'/><category term='virus'/><category term='messenger RNA'/><category term='social science'/><category term='inductive reasoning'/><category term='An Experiment with an Air Pump'/><category term='dominance'/><category term='IRBs'/><category term='New England Journal of Medicine'/><category term='pedophile scandal'/><category term='digit ratio'/><category term='extraterrestrial intelligence'/><category term='space travel'/><category term='&apos;best practice&apos;'/><category term='retraction'/><category term='medieval universities'/><category term='environmental risk factors'/><category term='nature of science'/><category term='Baby cries'/><category term='IQ'/><category term='whole genome sequencing'/><category term='experts'/><category term='Homo floresiensis'/><category term='adaptation'/><category term='heart disease'/><category term='Healthy People 2010'/><category term='chimpanzee'/><category term='Galileo'/><category term='RB1'/><category term='religiuos experience'/><category term='JAMA'/><category term='B vitamins'/><category term='homosexuality'/><category term='C57BL/6J mouse strain'/><category term='hominin'/><category term='spending'/><category term='resveratrol'/><category term='neutrinos'/><category term='nazis'/><category term='In Memoriam'/><category term='enamel'/><category term='Huxley'/><category term='innovative thinking'/><category term='heart disease mortality'/><category term='complex traits'/><category term='cell phones. brain cancer'/><category term='biomedical genetics'/><category term='Heisinberg Principle'/><category term='infant brain'/><category term='genotype risk scores'/><category term='diabetes'/><category term='Henry Louis Gates Jr'/><category term='racism'/><category term='pseudogenes'/><category term='carcinogens'/><category term='rare variants'/><category term='cosmology'/><category term='animal models'/><category term='phenogenetics'/><category term='language'/><category term='biological mechanisms'/><category term='sequestration'/><category term='fMRI'/><category term='hippocrates'/><category term='schizophrenia'/><category term='depression'/><category term='apes'/><category term='Burgess Shale'/><category term='alcohol'/><category term='heritable disease'/><category term='Tree of Life'/><category term='Mendelian diseases'/><category term='priorities'/><category term='senescence'/><category term='hunting'/><category term='throwing'/><category term='hubris'/><category term='Rachel Carson'/><category term='ancestry testing'/><category term='genetic architecture'/><category term='crowdsourcing'/><category term='categorization'/><category term='Mendelian genetics'/><category term='randomness'/><category term='parsimony'/><category term='Genome 10K'/><category term='ring species'/><category term='race genetics'/><category term='phenotypes'/><category term='shortsightedness'/><category term='multicellular organisms'/><category term='Guatemala'/><category term='systems biology'/><category term='Uniformitarianism'/><category term='science reporting'/><category term='origin of species'/><category term='deep time'/><category term='principles of life'/><category term='hygiene hypothesis'/><category term='Stewart Falls'/><category term='ForSim'/><category term='academic publishing'/><category term='aging'/><category term='globalization'/><category term='Galenic medicine'/><category term='bird song dialect'/><category term='ribs'/><category term='blood-letting'/><category term='E. coli'/><category term='BDNF'/><category term='evolution of the hand'/><category term='sex'/><category term='Tent Rocks'/><category term='myalgic encephalitis'/><category term='deletions'/><category term='contingency'/><category term='vertebrate genomes'/><category term='macromolecules'/><category term='Charles Darwin'/><category term='murder'/><category term='fecundity'/><category term='scientific inference'/><category term='DeCode Genetics'/><category term='adaptability'/><category term='perennial crops'/><category term='telescopes'/><category term='mouse genome sequencing'/><category term='genomics'/><category term='birth defects'/><category term='innate immunity'/><category term='prediction'/><category term='gene mapping'/><category term='cause and effect'/><category term='additive models'/><category term='massage'/><category term='Industrial Revolution'/><category term='bioprecipitation'/><category term='complex disease'/><category term='culture'/><category term='media hype'/><category term='The Far Side'/><category term='free will'/><category term='pleiotropy'/><category term='games'/><category term='Joseph Wright'/><category term='British Journal of Cancer'/><category term='human papilloma virus'/><category term='complex causation'/><category term='HMS Beagle'/><category term='economics'/><category term='expressions'/><category term='irremediable complexity'/><category term='DNA forensics'/><category term='Jen Wagner'/><category term='Australopithecus erotomanus'/><category term='evolutionary time scale'/><category term='evolution of color vision'/><category term='regulatory elements'/><category term='artificial selection'/><category term='PRDM9'/><category term='dementia'/><category term='genetic discrimination'/><category term='single celled organisms'/><category term='scientific humility'/><category term='Karl Marx'/><category term='lymphatic erection'/><category term='Tennyson'/><category term='Nature-Nurture'/><category term='miRNA'/><category term='invasive species'/><category term='mating calls'/><category term='development'/><category term='immigration'/><category term='competition'/><category term='birds'/><category term='australopithecus'/><category term='population expansions'/><category term='transgenics'/><category term='genome'/><category term='bioinformatics'/><category term='epigenome'/><category term='Bollocks Principle'/><category term='evidence-based medicine'/><category term='multiple sclerosis'/><category term='Marcus du Sautoy'/><category term='hippocratic oath'/><category term='cell phones'/><category term='anti-oxidants'/><category term='human genome sequence'/><category term='picorna-like virus'/><category term='cost-benefit analysis'/><category term='sand fleas'/><category term='Shelagh Stephanson'/><category term='science funding'/><category term='individual'/><category term='rare disease'/><category term='sexism'/><category term='Mendel'/><category term='classic Darwinism'/><category term='goats'/><category term='cervical cancer'/><category term='dark matter'/><category term='molecular selection'/><category term='evolutionary psychology'/><category term='assisted suicide'/><category term='Brca1'/><category term='QTL'/><category term='dirt'/><category term='two-hit model'/><category term='cancer treatment'/><category term='mosquitoes'/><category term='rescue behavior'/><category term='Nicola Clayton'/><category term='molecular Koch postulates'/><category term='Alfred Russel Wallace'/><category term='violence'/><category term='naked ape'/><category term='memory'/><category term='barnacles'/><category term='Creationism'/><category term='human genome'/><category term='facultativeness'/><category term='Bt cotton'/><category term='MHC'/><category term='predictability of phenotypes'/><category term='selection'/><category term='chordate'/><category term='race'/><category term='pesticides'/><category term='silverbacks'/><category term='Forensic genetics'/><category term='holly dunsworth'/><category term='phenotype'/><category term='science journalism'/><category term='existence of God'/><category term='computational biology'/><category term='deduction'/><category term='sperm'/><category term='emics'/><category term='penthouse'/><category term='origins of life'/><category term='caloric restriction'/><category term='symbiosis'/><category term='Koch postulates'/><category term='eugenics'/><category term='Annie Darwin'/><category term='transubstantiation'/><category term='Out of Africa'/><category term='adaptive immune system'/><category term='ancestry'/><category term='confounding'/><category term='Gifford lectures'/><category term='Personal Genome Project'/><category term='amoeba'/><category term='hypokalemic periodic paralysis'/><category term='theory'/><category term='scientific publishing'/><category term='genetic counseling'/><category term='savanna hypothesis'/><category term='enhanced memory'/><category term='gemmules'/><category term='migration'/><category term='retinoic acid'/><category term='oceans'/><category term='science as the solution'/><category term='natural selection in humans'/><category term='phlebotomy'/><category term='scientific integrity'/><category term='CCD'/><category term='archaeology'/><category term='Ibn Khaldun'/><category term='stone tool'/><category term='single-gene'/><category term='ETs'/><category term='conserved DNA sequence'/><category term='gender'/><category term='darwinism'/><category term='immune system'/><category term='just-so stories'/><category term='sexual dimorphism'/><category term='dehydrons'/><category term='numerosity'/><category term='vertebrate'/><category term='Central Dogma'/><category term='conservation of form'/><category term='morality'/><category term='playboy'/><category term='Alzheimer&apos;s disease'/><category term='beer'/><category term='environmental determinism'/><category term='Women Who Want to Want'/><category term='hypothesis'/><category term='association  studies'/><category term='association studies'/><category term='Hayflick limit'/><category term='group selection'/><category term='Charles Lyell'/><category term='bacteria'/><category term='screening'/><category term='psychology'/><category term='free radicals'/><category term='lifestyle intervention'/><category term='spontaneous generation'/><category term='gene flow'/><category term='tissue organization field theory'/><category term='Muqaddimah'/><category term='Human Microbiome Project'/><category term='Holocaust'/><category term='virome'/><category term='malaria'/><category term='nanotechnology'/><category term='gestational learning'/><category term='Ark Encounter'/><category term='cultural evolution'/><category term='population genetics'/><category term='norms of reaction'/><category term='plant defenses'/><category term='medical news'/><category term='stochasticity'/><category term='forwards'/><category term='bias'/><category term='exercise'/><category term='VX-770'/><category term='googlewhacking'/><category term='negative results'/><category term='extraterrestrial life'/><category term='bat fellatio'/><category term='enlightment'/><category term='Christopher Hitchins'/><category term='Hill criteria'/><category term='migraine'/><category term='candidate genes'/><category term='Strange  Brew'/><category term='Crows'/><category term='cells'/><category term='autism'/><category term='sexual selection'/><category term='hkpp'/><category term='Nationality Act'/><category term='reason'/><category term='metagenomics'/><category term='war on cancer'/><category term='ClimateGate'/><category term='Ibn Arabi'/><category term='limbs'/><category term='phenogenetic drift'/><category term='oupoli'/><category term='antisense RNA'/><category term='tuberculosis'/><category term='human genome diversity'/><category term='sensory development'/><category term='New York Times'/><category term='Japan'/><category term='Jonathan Pritchard'/><category term='human genetics'/><category term='public intellectuals'/><category term='nuns'/><category term='manic-depressive'/><category term='WHO'/><category term='sugar'/><category term='policy making'/><category term='musings'/><category term='genetic engineering'/><category term='lobbying'/><category term='history of science'/><category term='cystic fibrosis'/><category term='informed consent'/><category term='Penn State football'/><category term='MODY'/><category term='mouse genome'/><category term='butterfly phylogeny'/><category term='pparg'/><category term='experimentation'/><category term='ratites'/><category term='HIV'/><category term='CNVs'/><category term='scientific fraud'/><category term='consciousness'/><category term='DNA sequencing'/><category term='de Finetti'/><category term='overpopulation'/><category term='G-spot'/><category term='plasticity'/><category term='personalized &apos;genomic&apos; medicine'/><category term='complexity'/><category term='de-evolution'/><category term='evolution'/><category term='coevolution'/><category term='GWAS'/><category term='induction'/><category term='bipedalism'/><category term='Elizabeth Barrett Browning'/><category term='pathogens'/><category term='Simonyi Professor for the Public Understanding of Science'/><category term='preventive medicine'/><category term='Gaia'/><category term='allergy'/><category term='grants'/><category term='PSA tests'/><category term='sociobiology'/><category term='obesity'/><category term='simple trait'/><category term='stress'/><category term='Isaac Newton'/><category term='Newshour'/><category term='tenure'/><category term='pathways'/><category term='mouse model'/><category term='culture of science'/><category term='statistical dominance'/><category term='p-prims'/><category term='mosquito eradication'/><category term='homocysteine'/><category term='Cancun'/><category term='pervasive transcription factor'/><category term='color blindness'/><category term='retinoblastoma'/><category term='grantsmanship'/><category term='Germany'/><category term='bifidobacterium'/><category term='fossils'/><category term='Higg&apos;s Boson'/><category term='modularity'/><category term='Jerry Sandusky'/><category term='Starry Messenger'/><category term='religion'/><category term='Lamarck'/><category term='scientific writing'/><category term='primates'/><category term='important research topic'/><category term='Jaume Bertranpetit'/><category term='myelination'/><category term='genetic disease'/><title type='text'>The Mermaid's Tale</title><subtitle type='html'>A conversation about the nature of genetic causation in evolution, development and ecology.</subtitle><link rel='http://schemas.google.com/g/2005#feed' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/posts/default'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default?max-results=100'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/'/><link rel='hub' href='http://pubsubhubbub.appspot.com/'/><link rel='next' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default?start-index=101&amp;max-results=100'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><generator version='7.00' uri='http://www.blogger.com'>Blogger</generator><openSearch:totalResults>757</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>100</openSearch:itemsPerPage><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2411708191387678521</id><published>2012-02-02T08:34:00.001-05:00</published><updated>2012-02-02T17:19:32.987-05:00</updated><title type='text'>February CoE</title><content type='html'>The 44th Carnival of Evolution, up at &lt;a href="http://theatavism.blogspot.com/"&gt;The Atavism&lt;/a&gt;.&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://4.bp.blogspot.com/-xXtVSFW-jG4/TyqQvaXA3jI/AAAAAAAACQk/C3FSKIJJx3U/s1600/CoEButton.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="200" src="http://4.bp.blogspot.com/-xXtVSFW-jG4/TyqQvaXA3jI/AAAAAAAACQk/C3FSKIJJx3U/s200/CoEButton.jpg" width="200" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2411708191387678521?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2411708191387678521/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/02/44th-carnival-of-evolution-up-at.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2411708191387678521'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2411708191387678521'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/02/44th-carnival-of-evolution-up-at.html' title='February CoE'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/-xXtVSFW-jG4/TyqQvaXA3jI/AAAAAAAACQk/C3FSKIJJx3U/s72-c/CoEButton.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-8429344025829824721</id><published>2012-02-02T05:10:00.003-05:00</published><updated>2012-02-02T08:39:33.405-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='scientific method'/><category scheme='http://www.blogger.com/atom/ns#' term='deduction'/><category scheme='http://www.blogger.com/atom/ns#' term='induction'/><category scheme='http://www.blogger.com/atom/ns#' term='genetic code'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><title type='text'>Triumph of the Darwinian Method, continued:  genetics as function, function as history</title><content type='html'>So a powerful reason that the universal approach to biological questions was inspired by Darwin's theory of evolution (descent with modification), is that history leaves a trace in gene sequences, and gene sequences reveal history.&amp;nbsp; Even a sequence that, statistically, is random by itself, is very non-random when compared to other sequences.&amp;nbsp; That's because all DNA sequences are, in the history of life sense, related.&amp;nbsp; They may be statistically random along the chain of nucleotides, but they are very much not random when compared to each other.&lt;br /&gt;&lt;br /&gt;The same is true when we look into the structure of a DNA sequence, where once again history shows why what may seem random is anything but.&amp;nbsp; Again, it is the Darwinian method, and the assumption of common ancestry, that makes it possible to understand this.&lt;br /&gt;&lt;br /&gt;A century of work has shown us that DNA is related to the functions that go on in cells, in ways that are essentially common to all aspects of life.&amp;nbsp; This has to do with how those functions are encoded in DNA, and once we know how to read the code, we can also see both persuasive evidence for natural and other forms of selection, but also that make sense strictly in light of life as history.&lt;br /&gt;&lt;br /&gt;Here is a sequence of part of a human&amp;nbsp; gene: (gastrin):&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://3.bp.blogspot.com/-hbp-0qcMuM0/Tykxx3ztJ1I/AAAAAAAAAJ4/gFLpxfcPzrU/s1600/Screen+shot+2012-02-01+at+7.35.25+AM.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="400" src="http://3.bp.blogspot.com/-hbp-0qcMuM0/Tykxx3ztJ1I/AAAAAAAAAJ4/gFLpxfcPzrU/s400/Screen+shot+2012-02-01+at+7.35.25+AM.png" width="381" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;We picked this as a nice figure showing what we want, from a human genetics textbook by G. Moroni, 2001.&amp;nbsp; The nucleotide sequence is in black, and the amino acid sequence, or protein code, is in brown, written under the nucleotide code.&amp;nbsp; By itself, the DNA sequence appears just to be random nucleotides scrambled in a row.&amp;nbsp; But here are labeled various parts that &lt;i&gt;make &lt;/i&gt;it a gene: where messenger RNA is transcribed and the amino acids it codes for (brown), where the regulatory proteins bind to make this happen the TTATA in color), and a signal for where a string of A's will be attached (AAATAAA).&amp;nbsp; These types of features, and others not shown, can be identified nowadays just by analyzing a naked DNA sequence.&lt;br /&gt;&lt;br /&gt;You can go to what is called a genome '&lt;a href="http://genome.usc.edu/"&gt;browser&lt;/a&gt;' (the link is to the UCSC genome browser) and see the many structural and functional elements of DNA for any gene you can name in any species for which we have the DNA sequence.&amp;nbsp; Here it is for the gastrin gene. The top lines are the sequence location, then the gene with its protein-coding parts (dark boxes), connected by a thin blue line for the noncoding parts (called introns), showing where the gene code begins and ends, and belowthat a grey bar whose darkness reflects the degree of sequence &lt;i&gt;conservation&lt;/i&gt;, or similarity with other species, and below that black boxes showing the location of various short sequence elements that are 'motifs' found exactly or nearly repeated in many places in the human and other related species' genomes:&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://4.bp.blogspot.com/-wm7opEVmE9I/Tyk2vtnsbaI/AAAAAAAAAKA/88nJFzmwBGg/s1600/Screen+shot+2012-02-01+at+7.55.33+AM.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="38" src="http://4.bp.blogspot.com/-wm7opEVmE9I/Tyk2vtnsbaI/AAAAAAAAAKA/88nJFzmwBGg/s320/Screen+shot+2012-02-01+at+7.55.33+AM.png" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;A browser can show many other features, but a snapshot showing them all would utterly clog this post (but, you can see the results for the gastrin gene &lt;a href="http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr17:39868578-39872221&amp;amp;hgsid=240662807&amp;amp;knownGene=pack&amp;amp;hgFind.matches=uc002hxl.3,"&gt;here&lt;/a&gt;.)&amp;nbsp; Note for example that the coding regions are areas where the conservation bars are darkest.&amp;nbsp; That means that these areas are also very similar in sequence in other species for the 'same' gene. "Conservation", "same", "coding regions", etc., are all terms that refer to aspects of DNA we identify by &lt;i&gt;comparison&lt;/i&gt; or that are similar because of history--&lt;i&gt;shared ancestry&lt;/i&gt;.&amp;nbsp; And the reason some areas in and around the gene have varied or changed less during that history, that is, that are conserved in sequence, we know from all sorts of data, is that they are&amp;nbsp; &lt;i&gt;functional &lt;/i&gt;parts of the DNA.&amp;nbsp; As Darwin's theory would hold, they are important enough that mutational change in the DNA sequence probably did not work as well, and did not reproduce as well, as in less important areas: what Darwin called natural selection.&lt;br /&gt;&lt;br /&gt;We know these things because, after many decades of research, we have learned that the general features, like the code for amino acids that make up the protein (here, gastrin), are essentially &lt;i&gt;universal&lt;/i&gt;: that means that we can also find or identify these functional elements by various kinds of experiment, but the methods themselves derive from what's important: our ability to compare sequences of genes from any species or among species, and to compare sequences from the &lt;i&gt;same &lt;/i&gt;gene in different species.&amp;nbsp; Genes come and go, so we find the 'same' gene in sets of species that have diverged since the gene's origins.&lt;br /&gt;&lt;br /&gt;Because of this, because of shared history and common ancestry, what by  itself may seem to be an entirely random sequence of nucleotides,  becomes understandable as an entirely &lt;i&gt;non-random&lt;/i&gt; sequence when it comes to explaining what it does and why it exists. In fact, non-functional parts of the sequence may accumulate mutations randomly without selective constraint, but even they are transmitted faithfully (with occasional mutational change), and hence bear a trace of their history.&lt;br /&gt;&lt;br /&gt;From the point of view of the Darwinian method, that is, the aspects of the scientific method that Darwin's insights set rolling, these tools that are related to life's nature as shared history are fundamental to our modern understanding of life.&amp;nbsp; That is the triumph of the method.&lt;br /&gt;&lt;br /&gt;Thus, a truly random sequence (such as in our previous &lt;a href="http://ecodevoevo.blogspot.com/2012/02/triumph-of-darwinian-method-continued.html"&gt;post&lt;/a&gt;) would not only be statistically unpatterned itself (which is what 'random' means), but it would have none of the known functional structures that we know the evolution of life has produced in all its creatures, large and small.&amp;nbsp; That's why we'd be truly spooked by an actual sequence that not only didn't fit anywhere on the known tree of life's creatures, but also didn't show any elements that we are know that evolution has made fundamental to the nature of living organisms.&lt;br /&gt;&lt;br /&gt;There are still many things to be debated, about how to interpret various of these DNA-sequence factors, but not their nature as products of history.&amp;nbsp; One can debate the nature and role of natural selection, or the strength of effect of individual sequence variants on the traits (like presence of disease) of the organism carrying them.&amp;nbsp; We write all the time here on MT about over-stated claims about genetic causation and how easy it is to concoct adaptive Just-So stories.&amp;nbsp; The Darwinian method is so powerful that it lures scientists to excess, to uncritical acceptance of scenarios and claims that go beyond what really is scientifically legitimate--in some sense, just as Adam Sedgwick accused Darwin of doing:&amp;nbsp; assuming a theory which no facts could erode.&amp;nbsp; That's ideology, not science.&amp;nbsp; Scientists may indulge in such story-invention more, if anything, than Darwin himself did, so strong has a simplistic selectionist belief become in many quarters, either because a notion of Darwinian theory has been bought uncritically, or because as in many public arenas, education in biology has been a kind of Darwinian indoctrination.&lt;br /&gt;&lt;br /&gt;Iron-clad theories are self-fulfilling, and too many in science and the media, buy into facile stories.&amp;nbsp; There are many ways for differential proliferation of genetic variation and the traits it affects to occur or for variation to be distributed around the earth, of which natural selection is only one.&amp;nbsp; Temptation to invent stories notwithstanding, however, the aspects of the Darwinian method that we've tried to explain are so pervasive that there is no serious doubt about the historical nature of life on earth, which applies to all the competing explanations, and the fact that to persist or proliferate systematically, DNA sequence elements must have tolerable, or advantageous, function.&amp;nbsp; It should not have to be pointed out that this does not include creationist explanations, that do not require nor predict the kind of trace of history that we clearly observe.&amp;nbsp; Biologists are not arguing about the fact of life as history nor that that is why DNA sequences are nonrandom in ways they are nonrandom.&lt;br /&gt;&lt;br /&gt;Because evolution happened in the past, we must triangulate our approaches to understand it.&amp;nbsp; This is&amp;nbsp; why a mixture of repeated observation--induction--has been fundamental from Darwin to us today, and yet why deduction from a theory worked over the years by observation of DNA, leads us to predict what we'd find in some newly discovered sequence.&amp;nbsp; And for the same reasons, why neither induction nor deduction would help us explain a truly novel DNA sequence.&amp;nbsp; Scientific reasoning, especially when most things can't be proven by experiment and result from past events, must be a kind of social mix of various people taking various approaches, and combining their findings.&lt;br /&gt;&lt;br /&gt;At the core of this mix is what is known as the Darwinian method.&amp;nbsp; In a profound sense, whatever we in biology argue about, it isn't that!&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-8429344025829824721?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/8429344025829824721/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/02/triumph-of-darwinian-method-continued_02.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8429344025829824721'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8429344025829824721'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/02/triumph-of-darwinian-method-continued_02.html' title='Triumph of the Darwinian Method, continued:  genetics as function, function as history'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/-hbp-0qcMuM0/Tykxx3ztJ1I/AAAAAAAAAJ4/gFLpxfcPzrU/s72-c/Screen+shot+2012-02-01+at+7.35.25+AM.png' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-4358873114778101276</id><published>2012-02-01T05:48:00.001-05:00</published><updated>2012-02-01T07:25:09.757-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Tree of Life'/><category scheme='http://www.blogger.com/atom/ns#' term='Darwin'/><category scheme='http://www.blogger.com/atom/ns#' term='randomness'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='DNA sequence'/><title type='text'>Triumph of the Darwinian Method, continued:  genetics as history</title><content type='html'>Is a DNA sequence 'random'?&amp;nbsp; How would one know?&amp;nbsp; There are several tests for randomness that one can do on a DNA sequence, however it was derived -- there's a discussion of this issue &lt;a href="http://www.physicsforums.com/showthread.php?t=149442"&gt;here&lt;/a&gt;. For example, one can go down the sequence one nucleotide at a time and ask if that nucleotide can predict the next one in line.&amp;nbsp; One way is to ask whether the next ones are A, C, G, and T each 25% of the time.&amp;nbsp; That would mean that whatever the current nucleotide is, the next one is just unpredictable.&amp;nbsp; Then one can ask the same for the nucleotide 2, 4, ..., etc 12,287 positions down the row.&amp;nbsp; With some exceptions, such tests for predictability or periodicity would fail.&amp;nbsp; That means, the sequence is random!&lt;br /&gt;&lt;br /&gt;That is very weird, since DNA is responsible for organisms, and organisms seem to be anything &lt;i&gt;but&lt;/i&gt; random!&amp;nbsp; Or, could it be that at some higher level, organisms in this earth are, in some profound ways, 'random' in structure or behavior etc.?&lt;br /&gt;&lt;br /&gt;If I give you a DNA sequence, and you go into some program on the web (of which there are many) that searches all known DNA sequences to see which are closest to the test sequence, the expectation is that it will be an exact or near match to something known.&amp;nbsp; We have DNA sequence data from most branches of life, so we'd 'hit' a known species, or something similar in sequence.&amp;nbsp; That would pin our test sequence on the tree of relationships which to a Darwinian is a tree of life, and the key aspect of that is that the tree is the result of a &lt;i&gt;history&lt;/i&gt;.&lt;br /&gt;&lt;br /&gt;If this seems obvious, it is at the same time a profound reflection of the only convincing hypothesis about life, and here our method assumes a 'tree' and fits a sequence on it, and the only reason we can do this is because life is history.&amp;nbsp; If the sequence were from an individual already sequenced, there would be a complete match.&amp;nbsp; If it were from that individual's sibling, there would be a very close match.&amp;nbsp; If from the same population within a species, the similarity would be less but still very strong.&amp;nbsp; If from a different but 'related' species (say, two different forms of cat) again similarities would be clear--way more than with a bird or lizard or maple sequence.&amp;nbsp; This is only because of history, and it is only that fact that allows us to make sense of DNA similarities.&lt;br /&gt;&lt;br /&gt;Suppose you were given the following sequence:   &lt;br /&gt;&lt;div class="MsoNormal"&gt;ACGTCCAATCTGGGGTAAACCCGAGATCTGAGGCCTACCTGCAATTTCGGCCACACACAGGGTGTTACCCCGACTTCAGGGCA&lt;/div&gt;&lt;br /&gt;Now, go search the data bases for it, to see what known sequence it's closest to.&amp;nbsp; Here is what you'll find if you use a common tool, called &lt;a href="http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&amp;amp;BLAST_PROGRAMS=megaBlast&amp;amp;PAGE_TYPE=BlastSearch&amp;amp;SHOW_DEFAULTS=on&amp;amp;LINK_LOC=blasthome"&gt;BLAST&lt;/a&gt;, for comparing sequences: "No significant similarity found."&lt;a href="http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&amp;amp;PAGE_TYPE=BlastDocs&amp;amp;DOC_TYPE=FAQ"&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;Now, since we have sequence from basically every branch of life (though, at present, not whole genome sequence, to be sure, but this is a practical but not conceptual problem in our current context), how can our test sequence &lt;i&gt;not &lt;/i&gt;fit the tree?&amp;nbsp; If it really were unrelated to anything known, nor within the tree of known sequence, we would either have a sequence totally made up (which this one was!), or from a wholly unknown branch of life.&amp;nbsp; We have so much data at present, that such a result would be very spooky and unlikely.&amp;nbsp; Mutations arise randomly in DNA, relative to their effect on the organism, but even this kind of randomness is inherited, which is why even sequences that, by various statistical tests, seem to be random assemblages of nucleotides, fall into historical relationships with each other.&amp;nbsp; They may be 'random' on their own, but &lt;i&gt;not &lt;/i&gt;to each other.&lt;br /&gt;&lt;br /&gt;A sequence truly unrelated to any other could deeply threaten our very Darwinian foundations!&amp;nbsp; That is how strong and well-supported his hypothesis about life is.&amp;nbsp; If that is a failure of induction, then so be it.&amp;nbsp; We would go to very great lengths to find other explanations for our mysterious sequence, before we would even begin to question the hypothesis of evolution!&amp;nbsp; Would it be less weird than current allegations of meteorite structures, to suggest that such a sequence came from Mars?&amp;nbsp; Would it resuscitate arguments about spontaneous generation (see earlier post on this)?&lt;br /&gt;&lt;br /&gt;And in another way such a sequence would be at least as profound, or perhaps much more profound than just a missing relationship.&amp;nbsp; That is because, on its own DNA sequence can seem, statistically,&amp;nbsp; to be a random string of nucleotides--once we &lt;i&gt;know &lt;/i&gt;about history, and have experimental data (which we do, in profusion) we can see how utterly &lt;i&gt;nonrandom&lt;/i&gt; DNA sequences are when it comes to what they do--that cannot by itself be 'read' off from the sequence alone, without this information.&amp;nbsp; And this information is essentially connected to Darwinian ideas.&lt;br /&gt;&lt;br /&gt;This gets us to consider not just the fact of the tree of life's history, but the functional roles of DNA, and Darwin's other idea, that the tree is built by natural selection.&amp;nbsp; Comparative DNA sequences, viewed through the Darwinian method, also say something about that as well.&amp;nbsp; That is for next time in this series....&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-4358873114778101276?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/4358873114778101276/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/02/triumph-of-darwinian-method-continued.html#comment-form' title='9 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4358873114778101276'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4358873114778101276'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/02/triumph-of-darwinian-method-continued.html' title='Triumph of the Darwinian Method, continued:  genetics as history'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>9</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-8706234039602718596</id><published>2012-01-31T05:28:00.000-05:00</published><updated>2012-01-31T05:28:00.495-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='natural selection'/><category scheme='http://www.blogger.com/atom/ns#' term='deductive reasoning'/><category scheme='http://www.blogger.com/atom/ns#' term='Adam Sedgwick'/><category scheme='http://www.blogger.com/atom/ns#' term='Darwin'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='Enlightenment'/><category scheme='http://www.blogger.com/atom/ns#' term='descent with modification'/><category scheme='http://www.blogger.com/atom/ns#' term='inductive reasoning'/><title type='text'>Did Darwin run a pyramid scheme?  Darwinian method, continued</title><content type='html'>Before the period of the &lt;a href="http://en.wikipedia.org/wiki/Age_of_Enlightenment"&gt;Enlightenment &lt;/a&gt;in science, roughly starting with Francis Bacon and Galileo and others, about 400 years ago, a model of knowledge (among scientific types, at least, not farmers and craftsmen and others who actually earn a living) was largely attributed to Aristotle from around 400 BC.&amp;nbsp; According to this view of how we should figure out the world, we were hard-wired to understand the nature of Nature (sounds like a lot of genetic or Darwinian determinists, doesn't it?).&amp;nbsp; Thus, knowledge could be &lt;a href="http://en.wikipedia.org/wiki/Deductive_reasoning"&gt;deductive&lt;/a&gt; (the classic example of this is 1) All men are mortal, 2) Socrates is a man, 3) Therefore, Socrates is mortal).&amp;nbsp; The basic truths were known and were in that sense &lt;i&gt;axioms&lt;/i&gt; from which predictions about facts to be found could be &lt;i&gt;deduced&lt;/i&gt;.&amp;nbsp; In a sense, the facts were latent in the assumptions.&amp;nbsp; A theory came first, and led to many facts. &amp;nbsp;(The BBC Radio 4 program, &lt;i&gt;In Our Time&lt;/i&gt;, featured a nice &lt;a href="http://www.bbc.co.uk/programmes/b01b1ljm"&gt;discussion&lt;/a&gt; of the Scientific Method last week.)&lt;br /&gt;&lt;br /&gt;But the Enlightenment turned that idea on its head.&amp;nbsp; The idea was the scientific method that started with &lt;i&gt;observation &lt;/i&gt;rather than inspiration, and built up a pyramid of understanding.&amp;nbsp; First, by the process of &lt;a href="http://en.wikipedia.org/wiki/Inductive_reasoning"&gt;&lt;i&gt;induction&lt;/i&gt;&lt;/a&gt;, many observations were made, seen to be consistent, and they lay at the base of knowledge (All the swans I've ever seen are white, therefore all swans are white).&amp;nbsp; Other types of generalization built upon this base, to the top of a pyramid of understanding, the final theory that we infer from facts.&lt;br /&gt;&lt;br /&gt;When Darwin published his theory of evolution, of descent with modification screened by natural selection, from a common ancestral form, it was a challenge to accepted wisdom.&amp;nbsp; The scientific method was well established, but religious explanations of life were rife.&amp;nbsp; Darwin's theory certainly challenged this big-time!&lt;br /&gt;&lt;br /&gt;Now, Darwin amassed countless facts--it was one of his incredible fortes.&amp;nbsp; From these he inferred his theory, and on the face of it this would seem to be the scientific method if anything was.&amp;nbsp; But the geologist and former friend and teacher of Darwin's, Adam Sedgwick, was rather incensed by the theory of evolution.&amp;nbsp; Sedgwick was a seriously Christian believer, and could not abide this threat to all that he held dear.&amp;nbsp; He lambasted Darwin, not explicitly because Darwin contradicted biblical explanations, but because Darwin's theory was (in our words) Aristotelian rather than Baconian:&amp;nbsp; it was incorrect, old-fashioned and not real science at all!&lt;br /&gt;&lt;br /&gt;&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; text-align: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-oJBNMC3p66w/Tyam3uv2JFI/AAAAAAAACQM/929rhUEr1hs/s1600/450px-LaPyramideInvers%C3%A9elouvre.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" height="200" src="http://2.bp.blogspot.com/-oJBNMC3p66w/Tyam3uv2JFI/AAAAAAAACQM/929rhUEr1hs/s200/450px-LaPyramideInvers%C3%A9elouvre.jpg" width="150" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;Inverted pyramid, the Louvre&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;Sedgwick basically argued that Darwin inverted the proper pyramid of knowledge.&amp;nbsp; He claimed to be using inductive reasoning by bringing to bear so many different facts to form a consistent theory.&amp;nbsp; But in fact, argued Sedgwick, this was not induction at all!&amp;nbsp; That's because Darwin used the outcome of life that he observed as if he could draw conclusions from it inductively, when in fact life had only progressed on the Earth once!&amp;nbsp; Thus, Darwin was taking a &lt;i&gt;single &lt;/i&gt;observation, partitioned into many minute facts to be sure, but was generalizing about life as if evolution were observed again and again.&amp;nbsp; This, said Sedgwick, was old fashioned a priori theory driven reasoning that Aristotle would be proud of, but it did not have the empirical truth-value that the scientific method was developed to provide.&lt;br /&gt;&lt;br /&gt;In various discussions of this topic then and since, it appears that Darwin largely conceded the formal point, but of course stuck to his guns.&amp;nbsp; He could (and we can) predict new facts, but they are details that can immediately be fitted (or, Sedgwick would perhaps argue, be retro-fitted) into the theory.&amp;nbsp; Yes, there was diversity in the world, but this could arise by other processes (such as special Creation) and the theory of evolution was not the only explanation as a result.&amp;nbsp; It was not, argued Sedgwick, properly inductive.&lt;br /&gt;&lt;br /&gt;One could argue that we have used this theory in so many ways, modeled mathematically and experimentally in artificial selection, to predict formerly unknown phenomena about life, that the theory has clearly stood the test of time.&amp;nbsp; Many facts about the one process on earth, could be used to generalize about the process as if it could be repeated.&amp;nbsp; We argue that different species in different places each &lt;i&gt;do &lt;/i&gt;represent replicate observations from which the process of evolution can be induced.&amp;nbsp; Or, one could argue, inductive reasoning is just one way of getting at convincing accounts of the nature of Nature.&lt;br /&gt;&lt;br /&gt;One might even go all the way with Aristotle, and say that for the very reason that evolution did occur, our brains were adapted (by Darwinian processes!) so that we are built to understand Nature!&amp;nbsp; The argument probably wouldn't hold much water, but it's a thought.&amp;nbsp; In any case, the fact that evolution only occurred once does suggest that the idea was cooked up by Darwin in a non-inductive way--even if his theory was built upon countless observations, but of one single process.&lt;br /&gt;&lt;br /&gt;The triumph of the Darwinian method, to use the title of a book by Michael Ghiselin that we posted on in &lt;a href="http://ecodevoevo.blogspot.com/2011/10/triumph-of-darwinian-method.html"&gt;October &lt;/a&gt;and &lt;a href="http://ecodevoevo.blogspot.com/2011/11/triumph-of-darwinian-method-further.html"&gt;November &lt;/a&gt;2011, proliferates throughout the life sciences.&amp;nbsp; There are things that this allows us to do that are not exactly inductive, but are close to inductive reasoning in many ways.&amp;nbsp; This has to do with the nature of &lt;i&gt;variation&lt;/i&gt; and how it's to be explained.&amp;nbsp; In a next post we'll discuss this in light of DNA, totally unknown to Darwin.&amp;nbsp; There are substantial problems, and many of the inferences we make about specifics of the past are speculative, but overall, Darwin was not a Madoff, and did &lt;i&gt;not &lt;/i&gt;hustle us with a pyramid scheme!&amp;nbsp; &lt;br /&gt;&lt;br /&gt;We'll see how Darwinian concepts, more than any other, enable us to understand why DNA sequence can be 'random' on its own, in the sense that the A,C,G,T's along DNA are by various statistical tests&amp;nbsp; random: the nucleotides in one place don't predict those nearby or elsewhere along the sequence.&amp;nbsp; Yet the nucleotides are not just letters in a computer test, and are in fact anything but random.&amp;nbsp; Indeed, the concept of randomness has to be revised &lt;i&gt;because &lt;/i&gt;DNA sequences evolved.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-8706234039602718596?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/8706234039602718596/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/did-darwin-run-pyramid-scheme-darwinian.html#comment-form' title='20 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8706234039602718596'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8706234039602718596'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/did-darwin-run-pyramid-scheme-darwinian.html' title='Did Darwin run a pyramid scheme?  Darwinian method, continued'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-oJBNMC3p66w/Tyam3uv2JFI/AAAAAAAACQM/929rhUEr1hs/s72-c/450px-LaPyramideInvers%C3%A9elouvre.jpg' height='72' width='72'/><thr:total>20</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-6033560714869607840</id><published>2012-01-30T05:03:00.001-05:00</published><updated>2012-01-30T05:03:00.507-05:00</updated><title type='text'>Playing on the real strings, or just your heart strings?</title><content type='html'>&lt;a href="http://3.bp.blogspot.com/-Dg_qI5H_X7s/TyXsbT7QPuI/AAAAAAAACQE/EL9YiurDUtY/s1600/Gerald-TER-BORCH-xx-A-VIOLINIST-XX-HEREMITAGE.jpg" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"&gt;&lt;img border="0" height="320" src="http://3.bp.blogspot.com/-Dg_qI5H_X7s/TyXsbT7QPuI/AAAAAAAACQE/EL9YiurDUtY/s320/Gerald-TER-BORCH-xx-A-VIOLINIST-XX-HEREMITAGE.jpg" width="252" /&gt;&lt;/a&gt;A recent study of whether a combination of professional and amateur violinists preferred old or new violins has gotten a lot of press, &lt;a href="http://www.nytimes.com/2012/01/03/science/in-play-off-between-old-and-new-violins-stradivarius-lags.html"&gt;here&lt;/a&gt; first in the &lt;i&gt;NYT&lt;/i&gt;, and then again&amp;nbsp;&lt;a href="http://www.nytimes.com/2012/01/29/sunday-review/the-value-of-valuable-violins.html?_r=1&amp;amp;hp"&gt;yesterday&lt;/a&gt;. &amp;nbsp;The study was double-blinded, and 'scientifically run', and claims to be the first to properly test the hype about Stradivariuses. &amp;nbsp;Touted as 'gotcha' results, showing that people only think Strads are great because they are expensive, the &lt;i&gt;&lt;a href="http://www.pnas.org/content/early/2012/01/02/1114999109"&gt;study&lt;/a&gt;&lt;/i&gt;, published in the &lt;i&gt;Proceedings of the National Academy of Sciences&lt;/i&gt;, reported that experts can't tell whether they are playing a priceless Stradivarius or a violin by a modern maker. &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;We found that (i) the most-preferred violin was new; (ii) the least-preferred was by Stradivari; (iii) there was scant correlation between an instrument's age and monetary value and its perceived quality; and (iv) most players seemed unable to tell whether their most-preferred instrument was new or old. These results present a striking challenge to conventional wisdom.&lt;/blockquote&gt;&lt;a href="http://www.npr.org/blogs/deceptivecadence/2012/01/02/144482863/double-blind-violin-test-can-you-pick-the-strad"&gt;Here's&lt;/a&gt; the NPR treatment, complete with a sound test.&lt;br /&gt;&lt;br /&gt;So, the most recent &lt;i&gt;NYT&lt;/i&gt; story apparently accepts the comparative study, but it turns out that, according to our daughter Amie who is a professional violinist, by and large the world of professional musician does not. &amp;nbsp;In fact, one of the participants in the study says&amp;nbsp;&lt;a href="http://www.violinist.com/blog/laurie/20121/13039/"&gt;here&lt;/a&gt;&amp;nbsp;that they were not asked to identify the old violins, they were&amp;nbsp;asked to choose their preference. &amp;nbsp; She describes her experience:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Upon arriving, I was fitted with modified welders' goggles, and I entered a darkened room. I was then presented with 10 pairs of violins. For each pair, I had a minute to play whatever I wanted on the first violin, then a minute to play whatever I wanted on the second, without switching back and forth. After playing each for one minute, I was asked to choose which of the two I preferred. Then on to the next pair -- 10 times altogether. I thought I was testing 20 violins!&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;As it turns out, I was testing 6 violins, just paired up differently each time. One always was an old violin, the other was a modern, and they used different combinations against each other.&lt;/blockquote&gt;&lt;div&gt;She points out that the old instruments weren't optimized (sound post adjusted, new strings, etc), while the new instruments were. &amp;nbsp;&lt;/div&gt;&lt;blockquote class="tr_bq"&gt;The test was not over after the 20 violins, which were really six violins. After that part of it, the six violins were laid out on the bed, and I was given 20 minutes to play with them as I liked. My task was to choose which of these violins I would take home if I could, and also to decide which of the six was "best" and "worst" in each of four categories: range of tone colors, projection, playability and response.&lt;/blockquote&gt;She preferred one of the moderns, although she did say in her comments for the investigators that she thought it had potential, not that it was already great (good violins improve with time as they are played, although modern violins can either improve, or they can lose their sound, so the reputation of a modern maker is only enhanced if their violins stand the test of time). &amp;nbsp;That is, this violinist suspected it was a modern violin. &amp;nbsp;And, she points out that they were not asked whether they could tell the difference, just which they preferred -- despite the inferences all over the web that even professional violinists can't tell old from new, and only like Strads because they are expensive and have a mythic reputation.&lt;br /&gt;&lt;br /&gt;Another one of the participants, "an accomplished amateur violinist and violin maker", believes the study was well-run and the results perfectly credible, as he says &lt;a href="http://www.artsjournal.com/slippeddisc/2012/01/exclusive-how-i-blind-tested-old-violins-against-new.html"&gt;here&lt;/a&gt;. &lt;br /&gt;&lt;br /&gt;So, what's going on? &amp;nbsp;Was this a valid study or wasn't it? &amp;nbsp;Does it bust the Stradivarius myth? &amp;nbsp;Some violinists have pointed out that testing instruments in a small hotel room, where their sound can't project, seriously hinders a player's ability to judge. &amp;nbsp;Others that the researchers' &amp;nbsp;conclusions weren't properly inferrable from what the players were asked to judge, and of course if that is so, no matter how 'scientifically valid' the study was, the conclusions are largely the researchers' interpretations rather than objective findings.&amp;nbsp;&amp;nbsp; And, some of the participants were amateurs, and even if they were excellent musicians, their experience with playing in concert halls, where an instrument really makes a difference, is necessarily limited. Of course, musical quality is largely subjective and perhaps knowing the  instrument is a Strad can make some people enjoy it more. &amp;nbsp;And, the impartiality of the researchers, some of them modern instrument makers, might be an issue. &lt;br /&gt;&lt;br /&gt;The quality of the sound of a string instrument depends on many variables, not least of which is the listener's preferences. &amp;nbsp;But also, the bow with which it's played, the adjustment of the sound post, the quality of the strings, and even what kind of strings, what the player chooses to play, and whether it's the same piece on each instrument. &amp;nbsp;And so forth.&amp;nbsp; And of course, Strads have been fixed, tuned, adjusted, revarnished, and so on so that today's Strad is not the same as what Stradivarious himself built.&lt;br /&gt;&lt;br /&gt;This is not like judging red wine, which can just be poured into a glass, allowed to breathe for a set number of minutes, and then tasted. &amp;nbsp;Preference for wine is still subjective, but at least the factors that can influence its taste are part of the essence of the wine, unlike the music that comes out of a violin. If fact, it's been shown repeatedly that blindfolded, even experts  can't reliably tell if a wine is great or just good, or often, even if it's red  or white!&lt;br /&gt;&lt;br /&gt;Scientific methods can be applied to a multitude of questions, but the question has to be clear, the variables controlled, and the subjectivity of the answers at a minimum.&lt;br /&gt;&lt;br /&gt;&lt;i&gt;PNAS&lt;/i&gt; hitting the bell of deep science yet again!&amp;nbsp; Still, if not the most profound kind of science, mythbusting is important, even if it's not in the interest of vintners or, in the case  of violins, of auction houses. &amp;nbsp;But, should this study be considered the final word?&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-6033560714869607840?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/6033560714869607840/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/playing-on-real-strings-or-just-your.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/6033560714869607840'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/6033560714869607840'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/playing-on-real-strings-or-just-your.html' title='Playing on the real strings, or just your heart strings?'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/-Dg_qI5H_X7s/TyXsbT7QPuI/AAAAAAAACQE/EL9YiurDUtY/s72-c/Gerald-TER-BORCH-xx-A-VIOLINIST-XX-HEREMITAGE.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2717805733285726211</id><published>2012-01-27T05:19:00.002-05:00</published><updated>2012-01-27T16:42:49.424-05:00</updated><title type='text'>Hot flash (not hot flashes) of the week:  Who stops at red lights?</title><content type='html'>Well, dear MT readers, we hate to shock your tender sensitivities, but some times we feel absolutely &lt;i&gt;forced &lt;/i&gt;to confront you with truths that you may wish were kept hidden.&amp;nbsp; So here goes:&lt;br /&gt;&lt;br /&gt;A new paper by Shutt et al., in &lt;i&gt;Biodemography and Social Biology&lt;/i&gt;, reports from a whopping sample of&amp;nbsp; 612 men and 601 women, adolescents or very young adults, who self-reported about their sex-purchasing activity (was this marketing research?), that males pay for hookers much more than females do. We were blown away by this finding, but then even more impressed by the fact that this contemporary US survey of whopping size proved evolutionary theories about sex and parental investment.&amp;nbsp; Men&amp;nbsp; can just say screw the consequences (so to speak), while women are left changing the nappies (while the guys are out screwing other consequences).&lt;br /&gt;&lt;br /&gt;But then why are the women in the trade, given these evolutionary 'drives'?&amp;nbsp; Are they all forced, and if so how does that relate to evolution, since part of evolutionary theory is that males want their women to be chaste so they know who's the father of their children?&amp;nbsp; Or is this a financially viable career option for those who can't get a comparable job in banking (a similarly moral profession)?&amp;nbsp; Madams themselves are female, and they're doing the organizing.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;Our point is not to question the results of this paper, given their sample and the question they asked.&amp;nbsp; Rather, it's to question their relating this to more general theory.&amp;nbsp; Whether or not the behavioral evolutionary theory itself has merit, this seems like a misrepresentation of what we can, and can't, actually say about how evolution really worked as contrasted with how we think it might (should, or even 'must') work, and what kind of data we'd really need to say it. These kinds of data are possibly consistent with that theory, but hardly constitute strong support (or not) of it.&amp;nbsp; But publication of such speculations, which is routine these days, can give an impression to readers who don't know enough to be skeptical, that we know more than we really do.&amp;nbsp; The burden for such misrepresentations rests on the scientists and the journals that publish the work.&amp;nbsp; And when it comes to evolution-based determinism regarding behavior, history clearly proves that can have dangerous societal implications, in which the powers that be decide who's OK and who's not, and what to do (to them) about it.&amp;nbsp; Are hookers hookers because of their genes?&amp;nbsp; Are the guys customers because of their genes (that is, the genes that 'make them do it', not those they shed in their business transactions)?&amp;nbsp; If their genes made 'em do it, is it something 'we' have a right to 'treat'?&lt;br /&gt;&lt;a href="http://1.bp.blogspot.com/-P9wR9VoeASY/TwRnlK2ow6I/AAAAAAAAAII/P6hguimjkng/s1600/redlight1.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="200" src="http://1.bp.blogspot.com/-P9wR9VoeASY/TwRnlK2ow6I/AAAAAAAAAII/P6hguimjkng/s200/redlight1.jpg" width="173" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;Science representing itself as representing something generic and fundamental, should at least have data that are appropriately representative of that principle.&amp;nbsp; There are many reasons that males and females may have different reasons for stopping, or not stopping, at red lights.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2717805733285726211?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2717805733285726211/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/hot-flash-not-hot-flashes-of-week-who.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2717805733285726211'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2717805733285726211'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/hot-flash-not-hot-flashes-of-week-who.html' title='Hot flash (not hot flashes) of the week:  Who stops at red lights?'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-P9wR9VoeASY/TwRnlK2ow6I/AAAAAAAAAII/P6hguimjkng/s72-c/redlight1.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-3425346013331256407</id><published>2012-01-26T05:13:00.001-05:00</published><updated>2012-01-26T05:13:00.597-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='disgust'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='adaptability'/><title type='text'>That's disgusting! Make up your own Just-So story about the evolution of an emotion</title><content type='html'>&lt;b&gt;The evolution of disgust&lt;/b&gt;&lt;br /&gt;&lt;a href="http://4.bp.blogspot.com/-TwYWJbsQL68/Tx7ylxregLI/AAAAAAAACPQ/pdIeTZ9Nkko/s1600/File_Sipuncula.jpg_-_Wikimedia_Commons.jpg" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"&gt;&lt;img border="0" height="112" src="http://4.bp.blogspot.com/-TwYWJbsQL68/Tx7ylxregLI/AAAAAAAACPQ/pdIeTZ9Nkko/s200/File_Sipuncula.jpg_-_Wikimedia_Commons.jpg" width="200" /&gt;&lt;/a&gt;Everyone seems to be talking about disgust these days, from why it evolved to what parts of our brains light up when we feel it (it's the anterior insular cortex).&amp;nbsp; There was a &lt;a href="http://www.nytimes.com/2012/01/24/science/disgusts-evolutionary-role-is-irresistible-to-researchers.html?ref=science"&gt;story &lt;/a&gt;in the &lt;i&gt;NYT &lt;/i&gt;about it on Tuesday ("Survival's Ick Factor"), and a &lt;a href="http://www.nytimes.com/2012/01/22/books/review/thats-disgusting-unraveling-the-mysteries-of-repulsion-by-rachel-herz-book-review.html?ref=books"&gt;review &lt;/a&gt;of a new book (one of many) about it in the &lt;i&gt;Sunday NYT Book Review&lt;/i&gt;, a &lt;a href="https://sites.google.com/site/jasonanthonyclark/evolution-of-disgust-2012"&gt;conference &lt;/a&gt;in Germany, and an &lt;a href="http://rstb.royalsocietypublishing.org/content/366/1583"&gt;issue &lt;/a&gt;of the &lt;i&gt;Philosophical Transactions of the Royal Society &lt;/i&gt;devoted to the subject&lt;i&gt;.&amp;nbsp; &lt;/i&gt;Darwin included disgust in his list of the 6 basic human emotions, and wrote of seeing it on the faces of his infant children.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;Indeed, it seems that disgust now explains many human characteristics from tribalism, to disease avoidance, to poison critter avoidance, and mate choice.&amp;nbsp; And, disgust gone haywire explains psychological pathologies from obsessive compulsive disorder to excessive anxiety.&lt;br /&gt;&lt;br /&gt;A &lt;a href="http://muse.jhu.edu/journals/perspectives_in_biology_and_medicine/v044/44.1curtis.html"&gt;paper &lt;/a&gt;in &lt;i&gt;Perspectives in Biology and Medicine &lt;/i&gt;in 2001 lists the basic disgust elicitors.&amp;nbsp; &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;We suggest that the objects or events which elicit disgust can be placed in the following five broad categories:  &lt;/blockquote&gt;&lt;div align="JUSTIFY"&gt;&lt;/div&gt;&lt;blockquote class="tr_bq"&gt;1. Bodily excretions and body parts  &lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;div align="JUSTIFY"&gt;2. Decay and spoiled food  &lt;/div&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;div align="JUSTIFY"&gt;3. Particular living creatures  &lt;/div&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;div align="JUSTIFY"&gt;4. Certain categories of "other people"  &lt;/div&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;5. Violations of morality or social norms &lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;a href="http://4.bp.blogspot.com/-TsTMEzslaEQ/Tx70QGRN0OI/AAAAAAAACPg/PDs9sqkdDmM/s1600/bugs-insects-as-food-295x195.png" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="132" src="http://4.bp.blogspot.com/-TsTMEzslaEQ/Tx70QGRN0OI/AAAAAAAACPg/PDs9sqkdDmM/s200/bugs-insects-as-food-295x195.png" width="200" /&gt;&lt;/a&gt;Bodily secretions are the most widely reported elicitors of the disgust emotion. Feces appear on all of the lists, while vomit, sweat, spittle, blood, pus, and sexual fluids appear frequently. Body parts, such as nail clippings, cut hair, intestines, and wounds, evoke disgust, as do dead bodies. Certain animals are repeatedly mentioned, in particular pigs, dogs, cats, fish, rats, snakes and worms, lice, cockroaches, maggots, and flies. Spoiled food, especially meat and fish, and other decaying substances, such as rubbish, are disgusting to many respondents. Certain categories of other people are also found disgusting, notably those who are perceived as being either in poor health, of lower social status, contaminated by contact with a disgusting substance, or immoral in their behavior.&lt;/blockquote&gt;And then there are sensory cues, smells, feel, sounds.&amp;nbsp; A number of writers explain that all these things are disgusting because they remind us of our animal -- unhealthy? -- origins.&amp;nbsp; Others say it evolved to defend body and soul from pollution (as apparently being reminded of our animal origins pollutes the soul).&amp;nbsp;&amp;nbsp; &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;In their exploration of Darwinian medicine, Nesse and Williams (&lt;i&gt;Evolution and Healing&lt;/i&gt;, 1995) suggest that an instinctive disgust may motivate the avoidance of feces, vomit, and people who may be contagious, and that disgust is one of the mechanisms crafted by natural selection to help us keep our distance from contagion. Pinker (&lt;i&gt;How the mind works,&lt;/i&gt;1998) proposes that disgust is "intuitive microbiology," and that this explains our aversion to objects that have been in contact with disgusting substances: "Since germs are transmissible by contact, it is no surprise that something that touches a yucky substance is itself forever yucky."&amp;nbsp; &lt;/blockquote&gt;It's nice that this emotion is finally getting the attention that it clearly deserves.&lt;br /&gt;&lt;br /&gt;&lt;b&gt;But wait a second!&lt;/b&gt;&lt;br /&gt;Except -- there &lt;i&gt;had&lt;/i&gt; to be an except! -- except that a lot of this starts to sound suspiciously like just another elaborate evolutionary Just-So story.&amp;nbsp; New parents, nurses, physicians all quickly lose any disgust at bodily excretions, and one person's spoiled food is another's delicacy.&amp;nbsp; Just think of the rich array of foods that people on this planet eat.&amp;nbsp; Not to mention dogs, who'll eat just about anything. &amp;nbsp;Dogs share many of our emotions, and, if essentially all humans feel disgust, our sense of disgust had to have evolved earlier than we did, so shouldn't other lineages who share our disgust-feeling common ancestor, such as dogs, also share our supposedly instinctual disgust with eating, say, rotten meat, or vomit?&lt;br /&gt;&lt;br /&gt;&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://4.bp.blogspot.com/-of2kCEbLZ3s/Tx75xGlOUBI/AAAAAAAACPo/v4LOc43ZB3c/s1600/800px-Crocidura_hirta_%2528dead%2529.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" height="150" src="http://4.bp.blogspot.com/-of2kCEbLZ3s/Tx75xGlOUBI/AAAAAAAACPo/v4LOc43ZB3c/s200/800px-Crocidura_hirta_%2528dead%2529.jpg" width="200" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;Dead Zambian shrew, not Holly's shrew&lt;/td&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;&lt;br /&gt;&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;Which may explain why Holly reports holding up a dead shrew to her two dogs and finding that they wouldn't touch it.&amp;nbsp; She says her dogs would happily tear apart a dead squirrel, but not the shrew.&amp;nbsp; She thinks maybe it died of pesticide poisoning, though she couldn't smell anything.&amp;nbsp; Were they disgusted (by at least this one thing!), thus saving themselves from pesticide poisoning?&amp;nbsp; Or is it that they have learned to tear apart squirrels and not shrews?&amp;nbsp; Who knows?&lt;br /&gt;&lt;br /&gt;But then, why is it disgusting to some people to eat insects, while others thrive  on them (roasted, chocolate covered, etc.)?&amp;nbsp; Or why did Americans once  disdain disgusting lobster....and now drop big bucks for a nice, juicy  claw?&amp;nbsp; European Americans recoil at the thought of eating horse meat, while to many of their Old World brethren it's a delicacy. Or what about latakia pipe tobacco and lapsong suchong tea, 'cured' as one might say, over dung fires? &amp;nbsp;The list could go on and on and on, but what it means is that there's an obvious learned component.&lt;br /&gt;&lt;br /&gt;&lt;a href="http://3.bp.blogspot.com/-DOZLtbc7qac/Tx7ymKMCJeI/AAAAAAAACPY/9kaK4frABJI/s1600/Hostess_twinkies_tweaked.jpg" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"&gt;&lt;img border="0" height="125" src="http://3.bp.blogspot.com/-DOZLtbc7qac/Tx7ymKMCJeI/AAAAAAAACPY/9kaK4frABJI/s200/Hostess_twinkies_tweaked.jpg" width="200" /&gt;&lt;/a&gt;But, let's agree for the sake of argument that disgust as an emotional reaction in fact evolved as a specific trait.&amp;nbsp; And even that disgust might have its uses (though, too much of it can be a problem).&amp;nbsp; All this means is that, as other successful traits that have stood the test of evolutionary time, disgust itself is adaptable.&amp;nbsp; That is, yes, we may all feel disgust, but what disgusts us at any given time is culturally determined, not innate.&amp;nbsp; Otherwise, how could we learn that Twinkies were disgusting?&amp;nbsp; (Or not.&amp;nbsp; It turns out that if you search in Google Images for Twinkies, you'll find a &lt;a href="http://www.frugal-cafe.com/public_html/frugal-blog/frugal-cafe-blogzone/2011/01/28/fab-food-friday-fotos-chinese-style-stewed-meatballs-easy-tartlets-twinkie-fondue-kale-with-pecans-hobo-scramble-ricotta-basil-ravioli-winter-veggie-casserole-recipes-more/"&gt;photo &lt;/a&gt;of Twinkies Fondue; Twinkies, circus peanuts, caramel Ho-Hos, marshmallows, and candied orange slices on a skewer, waiting to be dipped into molten chocolate.&amp;nbsp; Or Scottish deep-fried Mars bars!&amp;nbsp; Who thinks these things up?)&lt;br /&gt;&lt;br /&gt;&lt;b&gt;Our better idea!&lt;/b&gt;&lt;br /&gt;And any of us can think of alternative hypotheses as to what disgust is 'for'.&amp;nbsp; Here's ours -- how about that it's part of our repertoire of communication, rather than an innate ability to save ourselves from decaying meat?&amp;nbsp; Why would we need a facial expression that communicates disgust if the emotion itself were the survival tactic, alerting us not to eat that rotting wildebeest?&amp;nbsp; Surely we could teach our children that even bunny rabbits were disgusting, if we started them young enough. &amp;nbsp;So, in adaptive terms, it's communicating &lt;i&gt;that&lt;/i&gt; we're disgusted that's important, not &lt;i&gt;what&lt;/i&gt; we're disgusted by.&amp;nbsp; Why?&amp;nbsp; Because it elicits caretaking, a survival tactic if there ever was one. And of course survival is very directly tied to evolutionary fitness.&lt;br /&gt;&lt;br /&gt;But all this hoopla about disgust is a bit disgusting itself.&amp;nbsp; Are we really desperate to have specialties so that someone can be called by the &lt;i&gt;NY Times&lt;/i&gt; "a pioneer of modern disgust research"? It's one thing to specialize, even to this extent, and perfectly legitimate to identify 'disgust' and try to understand its neurophysiology and physiological triggers -- if there really is an 'it'.&amp;nbsp; But it's quite another big step to attempt to Darwinize something so vague, and the fact that Darwin mentioned it doesn't change that.&amp;nbsp; Evolutionary scenarios are hard to pin down, even with well-defined traits.&amp;nbsp; The evidence by and large suggests that most of the human versions of this emotion, if it is a particular emotion, are learned and experiential and culture-specific -- adaptable.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;Obviously the inherent aspects, the 'adaptive' aspects of our disgusting behavior are unclear, hard to identify, harder to prove, and in any case it is not obvious that we have any such adaptations that were not in place eons before a human ever stepped on a wildebeest patty (barefoot--UGH!).&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-3425346013331256407?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/3425346013331256407/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/thats-disgusting-make-up-your-own-just.html#comment-form' title='25 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3425346013331256407'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3425346013331256407'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/thats-disgusting-make-up-your-own-just.html' title='That&apos;s disgusting! Make up your own Just-So story about the evolution of an emotion'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/-TwYWJbsQL68/Tx7ylxregLI/AAAAAAAACPQ/pdIeTZ9Nkko/s72-c/File_Sipuncula.jpg_-_Wikimedia_Commons.jpg' height='72' width='72'/><thr:total>25</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-4955053052154563807</id><published>2012-01-25T05:41:00.001-05:00</published><updated>2012-01-25T07:56:10.832-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='spontaneous generation'/><category scheme='http://www.blogger.com/atom/ns#' term='polymers'/><category scheme='http://www.blogger.com/atom/ns#' term='origins of life'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><title type='text'>Spontaneous combustion!  Life is not the same as organized life.  Part II.</title><content type='html'>The idea of spontaneous generation as debated by philosophers before the age of science referred not just to life as a particular kind of self-sustaining chemical reaction, but to that process as manifest in highly organized--&lt;i&gt;differentiated&lt;/i&gt;--organisms:&amp;nbsp; trees, beetles, worms, and all of us.&lt;br /&gt;&lt;br /&gt;Maggots--disgusting as they may be--are highly organized forms of life with anatomic structures, highly specialized cells, and that develop by developmental differentiation through sequential patterns of gene expression.&amp;nbsp; The idea of spontaneous generation referred to such complex creatures, and by extension to all organisms, not just bubbling primal soup.&lt;br /&gt;&lt;br /&gt;Even if such soup were to exist today in little cauldrons in the rocks or sea, it would not produce such organisms.&amp;nbsp; That is the key difference between life as a chemical phenomenon--which it most clearly is--and life as a complex ecology of different organisms, each of which is itself an internal ecology of different organs, which are ecologies of different cell types, and cells have their own internal ecology of subregions, specialized functions, and the like. &amp;nbsp;This is true even of bacteria, singly and in aggregates, fossils of which have been found from as early as 3.8 billion years ago.&amp;nbsp; &lt;i&gt;Those &lt;/i&gt;don't arise spontaneously!&amp;nbsp; And that is the very central key to why life is not like crystal formation, volcanoes, and solar systems.&amp;nbsp; And, of course, it's the deeply insightful awareness of this, by Charles Darwin and at the same time by Alfred Wallace, that we call 'evolution', that was one of the most transforming insights a human being ever had.&lt;br /&gt;&lt;br /&gt;Life is about continuation of a reaction--that's, after all, what you are relative to your parents, and &lt;i&gt;their &lt;/i&gt;parents, and theirs, and......so on back to the initial lively cauldron.&amp;nbsp; And more importantly, centrally, life is about the accumulation of divergence of subsets of this reaction.&amp;nbsp; Divergence requires isolation (we called it partial sequestration in &lt;i&gt;Mermaid's Tale&lt;/i&gt;), and transmission with memory (largely resident in DNA) that preserves divergence.&amp;nbsp; And the way that such divergence with memory accumulates in the kind of life we have here on earth, at least, is brought about by the fact that the basic processes of life are combinatorial and polymeric (see our &lt;a href="http://ecodevoevo.blogspot.com/2012/01/polymers-and-not-so-secret-secret-of.html"&gt;prior series&lt;/a&gt;&amp;nbsp;on this topic).&lt;br /&gt;&lt;br /&gt;Genes and the proteins they code for are polymers, long molecules of sequences of a few possible subunits, whose behavior depends on, resides in, and is all about the number, location, and arrangement of particular substrings along the polymer.&amp;nbsp; That is what accumulates 'information' over time and produces functional subdivision like tissues and organs.&lt;br /&gt;&lt;br /&gt;No matter what you may think of maggots (some people actually &lt;i&gt;eat &lt;/i&gt;them!), they are marvelously organized, complex forms of life.&amp;nbsp; New flies are not spontaneously generated; instead, they are just cellular continuations of parent flies.&lt;br /&gt;&lt;br /&gt;Any spontaneous generation of new 'living' (biochemical) reactions would simply be simple.&amp;nbsp; Organization of sequestered substructures and the DNA and protein polymers that make that possible, took hundreds of millions of years, if we can trust the earliest fossil evidence, found by our friend Bill Schopf at UCLA and others.&amp;nbsp; What we don't allow in modern biological thinking is spontaneous generation of highly &lt;i&gt;organized &lt;/i&gt;life.&amp;nbsp; It must be possible in principle: after all, you and we are just chemical reactions that were generated by the chemical reactions in the eggs that founded us and all the way back to the first soup.&amp;nbsp; But the probability that a bunch of molecules randomly bouncing around in some puddle in your back yard would generate a bacterial cell, much less a bunny rabbit, is astronomically small (if the universe is truly infinite, however, that must be occurring infinitely many times at this very instant and at &lt;i&gt;every&lt;/i&gt; instant--think about that for a while!).&lt;br /&gt;&lt;br /&gt;In boring mundane terms, at least, it's not happening here.&amp;nbsp; Nor are organized structures like, say, bunny ears, being generated out of a tadpole pond.&amp;nbsp; No, these things are products of very long &lt;i&gt;histories,&lt;/i&gt; not short-term instances.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;We need to carry the point forward, because it has fundamental lesson for our view of how evolution works and, generally, is strong support for and reflection of a key point in Darwin's founding theory of evolution.&amp;nbsp; It's that complex structures arise &lt;i&gt;gradually&lt;/i&gt;.&amp;nbsp; If bunny ears or even just maggots could arise spontaneously, Darwin rightly thought, religious Creationist arguments would be more plausible than historical evolutionary ones.&amp;nbsp; But the facts show that the evolutionary arguments are the only plausible ones of those that have been offered so far.&lt;br /&gt;&lt;br /&gt;Even when complex traits do seem to arise out of nowhere, such as extra vertebrae in the backs of children that were&amp;nbsp; not present in their parents, this is not spontaneous generation in the usual sense, because these are just anomalous repetitions of processes--like the one that generates vertebrae--that stutter more than usual.&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-DKFwtWO5UDo/Txx4AahpemI/AAAAAAAAAJg/9pznfo80pdM/s1600/Darwin-ToL-full-size-copy.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="276" src="http://1.bp.blogspot.com/-DKFwtWO5UDo/Txx4AahpemI/AAAAAAAAAJg/9pznfo80pdM/s400/Darwin-ToL-full-size-copy.jpg" width="400" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;This is why we never find, say, an organ from some dead organism that is  totally unlike anything ever seen before.&amp;nbsp; Nowhere on the tree of the major life-forms that we know of (image grabbed from the Smithsonian Museum's webpage: http://www.mnh.si.edu/exhibits/darwin/treeoflife.html).&amp;nbsp; Or, less fantastical, we  would never unearth a long DNA sequence that was totally unrelated to  that of any known type of organism--that could not be shown to fit  somewhere in the 'tree' of DNA sequences from plants, animals, and  microbes for which we do have sequence.&amp;nbsp; DNA sequences carry the  information for organisms, coding for their traits, and must reflect  their history.&amp;nbsp;&amp;nbsp; &lt;br /&gt;&lt;br /&gt;If&amp;nbsp; we really found a long DNA sequence with no similarity  to those we know of, and no structure (such as protein coding elements)  that are universal to the life we do know of, we would be in a real  quandry: it would be some trick, some product of a&amp;nbsp; DNA sequencing  machine rather than a remnant of actual life, or we would have to  rethink our entire theory of the history of life.&amp;nbsp; It would be very  exciting and upsetting--a lot of fun to live through--but there's no  sign of it happening.&lt;br /&gt;&lt;br /&gt;So this is the deeper sense in which biologists can seriously say that, yes, spontaneous generation did occur once, but no, it is not an explanation for subsequent life.&amp;nbsp; We're not having our cake and eating it too:&amp;nbsp; we're saying that a cake takes time to bake!&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-4955053052154563807?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/4955053052154563807/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/spontaneous-combustion-life-is-not-same.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4955053052154563807'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4955053052154563807'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/spontaneous-combustion-life-is-not-same.html' title='Spontaneous combustion!  Life is not the same as organized life.  Part II.'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-DKFwtWO5UDo/Txx4AahpemI/AAAAAAAAAJg/9pznfo80pdM/s72-c/Darwin-ToL-full-size-copy.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-8636573080760786569</id><published>2012-01-24T05:15:00.001-05:00</published><updated>2012-01-24T07:25:11.736-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Thomas Mann'/><category scheme='http://www.blogger.com/atom/ns#' term='spontaneous generation'/><category scheme='http://www.blogger.com/atom/ns#' term='polymers'/><category scheme='http://www.blogger.com/atom/ns#' term='origins of life'/><category scheme='http://www.blogger.com/atom/ns#' term='The Magic Mountain'/><title type='text'>Spontaneous combustion!  How life began, how life begins....  Part I.</title><content type='html'>How did life begin? &amp;nbsp;People who don't find the answer in the Bible often believe they'll find it in Darwin's &lt;i&gt;Origin of Species&lt;/i&gt;, but of course Darwin doesn't touch on the origin of life at all. &amp;nbsp;In fact, he doesn't even explain the origin of species. &amp;nbsp;But that's a story for another day.&lt;br /&gt;&lt;br /&gt;For centuries it was viable to speculate that life arose by spontaneous generation. Stuff in the soil, for example, came together to produce organisms.&amp;nbsp; Of course, the knowledge at that time did not permit definitive study of the question.&amp;nbsp; But one example was the apparent spontaneous appearance of maggots in dead meat. Ugh!&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-7av5M3_J65g/TxxQs2_mWcI/AAAAAAAAAJI/-OpqoPYEfAI/s1600/Fig2B.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="186" src="http://1.bp.blogspot.com/-7av5M3_J65g/TxxQs2_mWcI/AAAAAAAAAJI/-OpqoPYEfAI/s200/Fig2B.jpg" width="200" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;However,&amp;nbsp; in 1784 Lazzaro Spallanzani performed a famous experiment (duplicated below by Ken a few years ago, as he described &lt;a href="http://www.anthro.psu.edu/weiss_lab/CQ12_FrogInTaffetaPants.pdf"&gt;here&lt;/a&gt;) that showed these maggots only arose if the meat was exposed to flies, who laid their tiny, unobserved eggs on it.&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-Snq0dxkRQjo/TxxQt4BTpcI/AAAAAAAAAJY/70At1t5hEZE/s1600/Fig2A.gif" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="178" src="http://1.bp.blogspot.com/-Snq0dxkRQjo/TxxQt4BTpcI/AAAAAAAAAJY/70At1t5hEZE/s200/Fig2A.gif" width="200" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;The maggots did seem to appear spontaneously, but Spallanzani showed that if gauze were  placed over the meat, no maggots (Whew!).&amp;nbsp; Thus, we needed another  explanation, and in the age of science another type of spontaneous  generation, Creation of species as individual acts of God, wasn't  acceptable either.&amp;nbsp; Now, anyone who argues for spontaneous  generation is gently ushered to the psychological services center.&amp;nbsp; But  the story isn't quite so clear cut!&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/--0461_jOFgw/TxxQtef7ngI/AAAAAAAAAJQ/hpSd32Tuyp8/s1600/Fig2C.gif" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="150" src="http://2.bp.blogspot.com/--0461_jOFgw/TxxQtef7ngI/AAAAAAAAAJQ/hpSd32Tuyp8/s200/Fig2C.gif" width="200" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;In our book, &lt;i&gt;The Mermaid's Tale&lt;/i&gt;, we point out that people no longer believe in spontaneous generation .... except at the beginning, when organic life sprang spontaneously from inorganic elements. &amp;nbsp;Of course we were not the first to notice this inconsistency. &amp;nbsp;In fact, Thomas Mann wrote of it much more eloquently 85 years before we did.&lt;br /&gt;&lt;br /&gt;In his beautiful book,&amp;nbsp;&lt;i&gt;The Magic Mountain&lt;/i&gt;, Mann tells the story of Hans Castorp, a young naval engineer just embarking on his career. &amp;nbsp;He pays a visit to his cousin in a TB sanatorium, intending to stay for 3 weeks and then return to work, but he ultimately spends 7 years there. &amp;nbsp;Being set as it is in a place of illness, where both healing and death are integral parts of life, the book is full of musings about the meaning of life, death, time, work, illness, science, art and much more. &lt;br /&gt;&lt;br /&gt;Here's Mann on the origins of life (from the John E Woods translation).&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;What was life? &amp;nbsp;No one knew. &amp;nbsp;No one could pinpoint when it had emerged from nature and struck fire. &amp;nbsp;Nothing in the realm of life was self-actuated or even poorly actuated from that point on. &amp;nbsp;And yet life seemed to have actuated itself. &amp;nbsp;If anything could be said about it, then, it was this: life's structure had to be so highly developed that nothing like it could occur in the inanimate world. &amp;nbsp;The distance between an amoeba--a pseudopod--and a vertebrate was minor, insignificant in comparison to that between the simplest form of life and inorganic nature, which did not even deserve to be called dead--because death was merely the logical negation of life. &amp;nbsp;Between life and inanimate nature, however, was a yawning abyss, which research sought in vain to bridge. &amp;nbsp;people endeavored to close that abyss with theories--it swallowed them whole, and was still not an inch less broad or deep. &amp;nbsp;In the search for some link, scientists had stooped to the absurdity of hypothesizing living material with no structure, unorganized organisms, which if placed in a solution of protein would grow like crystals in a nutrient solution--whereas, in fact, organic differentiation was simultaneously the prerequisite and expression of all life, and no life-form could be proved that did not owe its existence to propagation by a parent. &amp;nbsp;What jubilation had greeted the first primal slime fished from the sea's deepest deeps--and what humiliation had followed. &amp;nbsp;It turned out that they had mistaken a precipitate of gypsum for protoplasm. &amp;nbsp;But to avoid one miracle (because it would be a miracle for life spontaneously to arise out of and return to the same stuff as inorganic matter), scientists had found it necessary to believe in another: archebiosis, that is, the slow formation of organic life from inorganic matter. &amp;nbsp;And so they went about inventing transitional and intermediate stages, assuming the existence of organisms lower than any known form, but which themselves were the result of even more primal attempts by nature to create life--attempts that no one would ever see, that were submicroscopic in size, and whose hypothesized formation pre supped a previous synthesis of protein.&amp;nbsp;&lt;/blockquote&gt;Mann goes on to answer the question of what is life poetically, as warmth produced by instability attempting to preserve form, the existence of that with no inherent ability to exist, and so on. &amp;nbsp;Mann needs no proof to support his answer, he can simply write it and it's there for as long as we can read. &lt;br /&gt;&lt;br /&gt;Scientists, though, still struggle with their assumed transitional forms and submicroscopic particles. We claim not to believe in spontaneous generation, but we accept that it occurred (but only once!) in the primordial soup.&amp;nbsp; That starting event wasn't an act of God, as deists might claim, but the fluke (spontaneous, not pre-ordained) coming together of the right chemicals, perhaps plus some lightning bolts, to start the reaction that we know today as 'life'.&lt;br /&gt;&lt;br /&gt;The idea that this occurred only once is preposterous.&amp;nbsp; It is far more likely that similar conditions in a similar span of time occurred trillions upon trillions of times within and among ponds, tides, shores, seas, rivers, lakes or wherever the magic soup occurred.&amp;nbsp; What we mean in science is that all of &lt;i&gt;today's &lt;/i&gt;life came from one origin.&amp;nbsp; It leaves its trace of that single start-up.&amp;nbsp; More on that in a moment.&lt;br /&gt;&lt;br /&gt;If we speculate on whether there are little green men (or even little red bacteria) on Mars, as a way of justifying costly tourist adventures there, then that's an acknowledgment that life arose by spontaneous combustion at least twice even within our own solar system! &amp;nbsp;(Unless of course we believe it was seeded on Earth by a meteor from Mars.) And if, as we discussed in &lt;a href="http://ecodevoevo.blogspot.com/2011/06/twilight-zone-part-i-is-there-life.html"&gt;previous posts&lt;/a&gt;&amp;nbsp;on life in the universe, there are billions of habitable planets, even just thinking of earth-like life, then spontaneous generation of life is a downright everyday occurrence.&amp;nbsp; And if one thinks there are nearly infinitely many such planets, spontaneous generation is necessarily occurring somewhere, right this very minute (can you feel it?)!&lt;br /&gt;&lt;br /&gt;So, it's not mysticism of any kind to argue for spontaneous generation.&amp;nbsp; And can we say that it is not still occurring, even here on earth?&amp;nbsp; One would have to rule out any possibility of the same chemical ingredients being present in right amounts anywhere on earth.&amp;nbsp; That seems at least somewhat unlikely (though, we think it is widely thought&amp;nbsp; that the actual origin of life was in an earth with oxygen-free atmosphere, so the question isn't so simple, and perhaps it's not occurring anywhere here any longer).&lt;br /&gt;&lt;br /&gt;How can we as scientists deny, much less denigrate, Creationism if we then in our next breath, adopt&amp;nbsp; Darwin's final metaphor in the &lt;i&gt;Origin&lt;/i&gt;, say that life was breathed into an otherwise inanimate earth?&amp;nbsp; The answer is simple, and relates to what is spontaneously being generated, and to the nature of life not just as a chemical phenomenon, but as a &lt;i&gt;&lt;a href="http://ecodevoevo.blogspot.com/2012/01/polymers-and-not-so-secret-secret-of.html"&gt;polymer&lt;/a&gt;&amp;nbsp;&lt;/i&gt;phenomenon, as we described in earlier posts.&amp;nbsp; In part II of this short series, we'll elaborate.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-8636573080760786569?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/8636573080760786569/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/spontaneous-combustion-how-life-began.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8636573080760786569'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8636573080760786569'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/spontaneous-combustion-how-life-began.html' title='Spontaneous combustion!  How life began, how life begins....  Part I.'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-7av5M3_J65g/TxxQs2_mWcI/AAAAAAAAAJI/-OpqoPYEfAI/s72-c/Fig2B.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-6519256787739686343</id><published>2012-01-23T05:41:00.012-05:00</published><updated>2012-01-23T11:01:41.008-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Al Knudson'/><category scheme='http://www.blogger.com/atom/ns#' term='retinoblastoma'/><category scheme='http://www.blogger.com/atom/ns#' term='RB1'/><category scheme='http://www.blogger.com/atom/ns#' term='cancer'/><category scheme='http://www.blogger.com/atom/ns#' term='two-hit model'/><title type='text'>Do we still not know what causes cancer?  Part V.  Simple complexity?</title><content type='html'>The insightful somatic mutational idea of Al Knudson's  that retinoblastoma (RB) was due to two mutational hits, that accounted for the onset at or near birth, was based on the single vs multiple, unilateral vs bilateral nature of the primary tumors, and the difference between sporadic and familial cases.&amp;nbsp; Knudson's &lt;a href="http://en.wikipedia.org/wiki/Knudson_hypothesis"&gt;two-hit model&lt;/a&gt; originally (way back in 1971) was basically about two different genes needing to be mutated.&amp;nbsp; At the time we knew little about cell-to-cell signaling environments and the like, nor about the kinds of genes--related to basic cellular function--that might be responsible.&amp;nbsp; As it turned out, the RB story seemed to be one of two mutations--but in the different copies of the same gene, that when discovered was named RB1.&amp;nbsp; It turns out to be a &lt;a href="http://en.wikipedia.org/wiki/Tumor_suppressor_gene"&gt;tumor suppressor or 'anti-oncogene'&lt;/a&gt;, one of the general classes of cancer-related mechanisms that research has identified.&lt;br /&gt;&lt;br /&gt;As we said in the previous posts in this series, a consistent picture of the generic nature of genetic factors, based on cells' context-related behavior, seemed to have emerged from this insight.&amp;nbsp; It turned out that RB and perhaps a few other childhood tumors fit this simple one gene model.&amp;nbsp; There were some problems, in that mice engineered to be RB1-negative did not consistently have RB nor sometimes any serious abnormality.&amp;nbsp; And RB1 is expressed in many different cells, but had little direct relevance to other cancers (tumors didn't appear in childhood in other tissues).&amp;nbsp; Even so, again for whatever reason, this seemed to be a single-gene, single-tissue problem.&amp;nbsp; The idea could be that cancer is causally simple, and the job was just to identify the genes in each case (some of us were writing, even then, that the age pattern of other cancers suggested that they seemed to require 'hits' in multiple genes).&lt;br /&gt;&lt;br /&gt;Cancer research following up on this and many other leads made great strides in many areas of basic cell biology and cellular communication--because cellular communication or cells sensing and responding to their environment is what complex organisms are all about. Cell-specific gene expression, signaling, and other aspects of cellular behavior were reflected in the abnormal cellular behavior of cancer.&amp;nbsp; RB1 inhibits cells from dividing until they are 'ready', meaning until other aspects of their behavior and responses have been set up (see Wikipedia: &lt;a href="http://en.wikipedia.org/wiki/Retinoblastoma_protein"&gt;Retinoblastoma protein&lt;/a&gt;).&lt;br /&gt;&lt;br /&gt;&lt;b&gt;New light on an old story&lt;/b&gt;&lt;br /&gt;But now even the RB story is turning out to be more subtle, and perhaps more complex than we had thought.&amp;nbsp; A &lt;a href="http://www.nature.com/nature/journal/v481/n7381/full/nature10733.html"&gt;new paper &lt;/a&gt;and &lt;a href="http://www.nature.com/nature/journal/v481/n7381/full/481269a.html"&gt;commentary &lt;/a&gt;in &lt;i&gt;Nature &lt;/i&gt;reports the story.&amp;nbsp; The question was &lt;i&gt;how &lt;/i&gt;do RB1-negative cells end up being cancer cells?&amp;nbsp; Why does the absence of this gene matter?&lt;br /&gt;&lt;br /&gt;The authors of the paper searched for other mutations in the genome in RB1 negative RB tumor cells, looking for evidence of a second 'hit'.&amp;nbsp; They did not find accumulating mutations.&amp;nbsp; In fact, they found that the retinoblastoma genome is more stable than that most other human cancers sequenced to date.&amp;nbsp; Rather than mutational or structural variations, they found that &lt;i&gt;epigenetic &lt;/i&gt;changes were common.&amp;nbsp; These involve chemical modification of the nucleotides in the cells, rather than DNA sequence changes, the usual definition of mutation.&amp;nbsp; The changes include &lt;a href="http://en.wikipedia.org/wiki/Methylation"&gt;methylation &lt;/a&gt;of DNA that affects nearby gene expression and modification of the proteins that wrap up DNA in the nucleus and in turn are used to unwrap the DNA in areas where genes need to be expressed.&lt;br /&gt;&lt;br /&gt;These modifications are driven by specific mechanisms that patrol DNA and, in ways not yet very well understood, modify it in chosen places.&amp;nbsp; But they do this systematically across the genome, making in a sense wholesale changes at a single go.&amp;nbsp; Those changes are somehow tissue context specific.&amp;nbsp; But the process does not require each site to be modified having to wait for a very rare mutational event.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;How RB1 protein affects cell cycle changes is not fully understood, but one thing that epigenetic changes can do is operate much faster than 'waiting' for a series of damaging DNA mutations to occur.&amp;nbsp; This works because epigenetic changes must occur all over the genome,  since specific tissues use (or don't use) many different genes scattered  across the chromosomes.&amp;nbsp; And tissue behavior can change, requiring  different expression patterns: so the expression-regulating epigenetic  changes have to be fast, modifiable, and reversible.&amp;nbsp; Which we know that  they are.&amp;nbsp; Thus this is a plausible mechanism for the early onset of  RB.&amp;nbsp; The authors identified a gene called SYK that may be particularly involved.&lt;br /&gt;&lt;br /&gt;By contrast, for example, &lt;a href="http://en.wikipedia.org/wiki/BRCA1"&gt;BRCA1&lt;/a&gt; mutations damage DNA repair mechanisms, so that the person inheriting or incurring mutations in that gene becomes vulnerable to other mutations in her cells,&amp;nbsp; unfortunately including cancer-related mutations, that the cell can't detect and fix.&amp;nbsp; This shortens the average 'waiting' time for enough changes that a badly-responding breast cell divides out of normal contextual control.&amp;nbsp; BRCA1 related breast cancer is usually earlier than other cases.&lt;br /&gt;&lt;br /&gt;&lt;b&gt;Many changes all at once?&lt;/b&gt;&lt;br /&gt;This may account for the early onset of the tumor when clearly just one aberrant gene doesn't alter so many aspects of the control of cell division and response.&amp;nbsp; Instead, the missing RB1 protein allows other processes involving many other genes to become deregulated--without having to be mutated themselves.&amp;nbsp; It would mean that RB as a disease is, like other cancers, the result of many changes in cell behavior, not just one.&amp;nbsp; In a sense that is reassuring, that we are correctly understanding that the mechanism of proper cooperation (to use MT's favorite term!) is required for appropriate cell behavior--appropriate in the sense that the pattern of cooperation evolved over time to produce the differentiated organ systems that we have in our bodies.&lt;br /&gt;&lt;br /&gt;What does this say about Knudson's original two-hit model?&amp;nbsp; It was both right and wrong.&amp;nbsp; RB is a simple one-gene disease from the mutational view, but it is not a carcinogenic &lt;i&gt;process&lt;/i&gt; that involves only one gene. &amp;nbsp; RB is a complex tumor, like other tumors, involving the &lt;i&gt;actions&lt;/i&gt; of many genes, and their &lt;i&gt;interactions&lt;/i&gt; with their contextual surroundings.&amp;nbsp; It is genetic in the sense that it involves aberrant use of many&amp;nbsp; genes, but it is contextual in that the genes are normal genes but mis-expressed in their context.&amp;nbsp; In truth, this is how all cancers are.&amp;nbsp; It just happens that this is driven by a single gene--or, of course, it could be that this works only in families transmitting otherwise unknown variation in genes that are vulnerable to these effects of the RB1 protein--that we don't yet know and would, like any GWAS problem, be challenging to discover. &lt;br /&gt;&lt;br /&gt;&lt;b&gt;A dangerous mix&lt;/b&gt;&lt;br /&gt;Overall, what we see is a mix of somatic or inherited mutation, that unfortunately modifies a cell in &lt;i&gt;non&lt;/i&gt;mutational ways, that are genetic in the functional sense, yet are context-related because they&amp;nbsp; make the cell behave is if its context were different from the normal retinal context.&amp;nbsp; This is a mix of the two basic ideas of causation (called SMT and TOFT) that the &lt;i&gt;BioEssays &lt;/i&gt;debate was about, and that originally triggered this series of commentaries.&amp;nbsp; In earlier installments in this series, we largely took sides, against the TOFT view, because it seemed to be in denial about the role that huge amounts of evidence provide for somatic mutations.&amp;nbsp; But as we've said in other parts of the series, no one can seriously argue that cancer is only genetic in the mutational sense, nor only involving somatic mutations.&amp;nbsp; The combination of causes is what is important and, we think, the age of onset pattern shows this.&lt;br /&gt;&lt;br /&gt;But one of the reasons the genetic theory (including both somatic and inherited mutations) is so strongly supported by the evidence is that a great deal of evidence shows that tumors are, by and large, &lt;i&gt;clones&lt;/i&gt;:&amp;nbsp; no matter how the tumor has spread in the body, all its millions of cells are descendants of a single 'transformed' cell.&amp;nbsp; There is evolution and genetic change among these cells, but they would share one or more changes that were there when that cell was transformed.&amp;nbsp; This is, we think, the typical finding.&amp;nbsp; There is, in fact, a new &lt;a href="http://www.nature.com/nature/journal/v481/n7381/full/nature10762.html"&gt;paper&lt;/a&gt; about the clonal nature of cancer in &lt;i&gt;Nature&lt;/i&gt;.&lt;br /&gt;&lt;br /&gt;By contrast, in any local cellular environment there are typically millions of cells, so that a screwy environment would misdirect responses in a great many cells, and the result would be a large number of primary tumors, and they would all look genetically normal. And they would have no reason to look so genetically abnormal as cancer cells.&amp;nbsp; Of course, abnormal cancer cells induce other perfectly normal cells, such as vessel-building cells, to provide nutrients, oxygen, and so on to the tumor cells.&amp;nbsp; So the tumor is much more than just the transformed cells.&amp;nbsp; The &lt;i&gt;Nature&lt;/i&gt; review makes this clear, and that context is part of the story, which is related in a way to the TOFT theory, even if the article is from a cellular-genetic point of view..&lt;br /&gt;&lt;br /&gt;Yes, we &lt;i&gt;do &lt;/i&gt;know what causes cancer--generically.&amp;nbsp; It's about basic biology and the complex mix of causation, cooperation, and context that is the nature of life.&amp;nbsp; It's conceptually simple, but complex, like most of life, in the details of each instance.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-6519256787739686343?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/6519256787739686343/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_23.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/6519256787739686343'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/6519256787739686343'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_23.html' title='Do we still not know what causes cancer?  Part V.  Simple complexity?'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-3277204919772859735</id><published>2012-01-21T11:44:00.002-05:00</published><updated>2012-01-23T08:10:16.125-05:00</updated><title type='text'>Give us a sporting chance!</title><content type='html'>Penn State is in the news everyday, and a long &lt;a href="http://www.nytimes.com/2012/01/22/education/edlife/how-big-time-sports-ate-college-life.html?hp"&gt;story&lt;/a&gt; in today's&amp;nbsp;&lt;i&gt;NY Times&lt;/i&gt;&amp;nbsp;hammers on the drum of athletics out of control in universities.&amp;nbsp; It's possible, as a few lucky universities show, to have both: good athletics and good academics, but the greatest academic universities in the world don't, by and large. So it may be a cash cow but athletic departments aren't vital to good academics. But what, exactly, do administrators even mean when they utter the flash-word 'academics', and promise to keep them in balance with athletics, as our new president has said?&amp;nbsp; What are they themselves actually thinking?&lt;br /&gt;&lt;br /&gt;&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://3.bp.blogspot.com/-MllakNm-QM0/TxrquwHm6dI/AAAAAAAACPI/qZOY2J5iip4/s1600/800px-Beaver_Stadium_inside.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" height="157" src="http://3.bp.blogspot.com/-MllakNm-QM0/TxrquwHm6dI/AAAAAAAACPI/qZOY2J5iip4/s320/800px-Beaver_Stadium_inside.jpg" width="320" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;Penn State's 108,000 seat Beaver Stadium&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;This is not so simple a matter, as the &lt;i&gt;Times&lt;/i&gt; story points out.&amp;nbsp; Unfortunately, they take Penn State specifically to task for empty verbiage on this score.&amp;nbsp; When the promise of restoring 'balance' is mentioned, not a word is said about what that means.&amp;nbsp; Basically, so far, what it means here is paying a lot of money to Madison Avenue to create a new spin, perhaps some images on university web pages of students actually studying, or something hefty like that.&lt;br /&gt;&lt;br /&gt;The truth is that SanduskyGate, which has been such a problem here at Penn State, is being treated as a problem for the athletic department.&amp;nbsp; There is heavy bemoaning of how our legendary coach Joe Paterno was forced to retire, with almost not a peep about the firing of the President.&amp;nbsp; Nobody gives a damn about him, it seems.&amp;nbsp; This safely sequesters the problem within the athletic department.&amp;nbsp; And here we're not referring to the incredibly tragic syzygy of awful events.&amp;nbsp; But the truth is much more profound than that.&lt;br /&gt;&lt;br /&gt;We got into this mess, and other universities are vulnerable to the same thing, because &lt;i&gt;as an institution&lt;/i&gt; we have been Republicanized: turned into a business to satisfy ourselves rather than our students, to raise money and take no chances.&amp;nbsp; We all know the grant system works that way--and by the way, this is not about Penn State but about all serious universities, of which we are clearly one.&amp;nbsp; We just had the bad luck to be embarrassed by it.&lt;br /&gt;&lt;br /&gt;When we say we vow to restore a balance between athletics and academics, we de facto put them on the same scale, as &lt;i&gt;equals&lt;/i&gt;!&amp;nbsp; That is preposterous!&amp;nbsp; And worse, of course we never say what 'academics' means.&amp;nbsp; That's because taking a stand on that is inconvenient; it takes guts and risk.&amp;nbsp; If we took it seriously, many students would not apply to come here--they even say in surveys that it's the athletics they come for.&amp;nbsp; That, in itself, is a preposterous big red flag.&amp;nbsp; And we're not alone, Paternoville or not.&lt;br /&gt;&lt;br /&gt;We know very well that America's educational system, from K-12 through universities, is complacently and seriously dropping the ball.&amp;nbsp; Students aren't learning, aren't doing much homework, don't know how to find the library, and aren't nearly keeping up with the other countries' students with whom we compete for wealth and security.&amp;nbsp; As the Roman Emperor said, when the people are restless, give them bread and circuses.&amp;nbsp; To keep our student clientele, and though nobody says it out loud, what we provide are dumbed-down classes and spectator sports (and drinking venues).&amp;nbsp; To keep our tuition flowing so we can pay our faculty members and a horde of administrators quite handsomely, we have to avoid students dropping out.&amp;nbsp; We have to have looser admission standards, and admit thousands more customers than in the past (and claim that that's a good thing).&amp;nbsp; Don't scare them away from classes by using big words or insisting on attendance or giving bad grades or calling students on cheating!&amp;nbsp; &lt;br /&gt;&lt;br /&gt;Science, our particular interest, to be done well requires properly skilled and trained professionals.&amp;nbsp; We're supposed to be providing them to society.&amp;nbsp; The current systematic backing down and easing up at universities--nationwide, not just here--is easy in the short-run but potentially devastating in the long run.&amp;nbsp; Broader scholarship than science, attitudes and nuances that make for more edifying lives and better citizens are similar.&lt;br /&gt;&lt;br /&gt;However, how many administrators have what it takes, to take the risk with their trustees and donors, to&amp;nbsp; make real rather than cosmetic image-centered changes that will redress the problems?&amp;nbsp; How much we wish our leaders would do that!&amp;nbsp; Could it happen here, a place we care a lot about, now that we have been handed the opportunity, even if on a tarnished platter?&lt;br /&gt;&lt;br /&gt;Leadership in such reform must be vigorous and persistent, because the problem is deep, systemic, and nationwide.&amp;nbsp; There will be resistance, even among faculty who won't want to change what or how often they teach or to demand more of better students, which demands more of themselves (&lt;i&gt;ourselves&lt;/i&gt;). The news stories are all about a football coach and a boy getting shafted in a shower. &amp;nbsp;While the sexual abuse is the tragedy here, for universities the wider story is the economic bath we're all going to have to take if our nation doesn't get out the soap and clean things up.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-3277204919772859735?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/3277204919772859735/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/give-us-sporting-chance.html#comment-form' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3277204919772859735'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3277204919772859735'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/give-us-sporting-chance.html' title='Give us a sporting chance!'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/-MllakNm-QM0/TxrquwHm6dI/AAAAAAAACPI/qZOY2J5iip4/s72-c/800px-Beaver_Stadium_inside.jpg' height='72' width='72'/><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-1122366294170398979</id><published>2012-01-20T05:23:00.002-05:00</published><updated>2012-01-20T08:16:18.144-05:00</updated><title type='text'>Do we still not know what causes cancer?  Part IV.  The classic case returns....</title><content type='html'>We have had a series of posts (starting &lt;a href="http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer.html"&gt;here&lt;/a&gt;) stimulated by a &lt;a href="http://onlinelibrary.wiley.com/doi/10.1002/bies.v33.5/issuetoc"&gt;debate&lt;/a&gt; in &lt;i&gt;&lt;a href="http://onlinelibrary.wiley.com/journal/10.1002/%28ISSN%291521-1878"&gt;BioEssays&lt;/a&gt;&lt;/i&gt; about whether one major idea about cancer, that it is due to somatic mutations (SMT), is correct, or whether a very different local-tissue-environment model (TOFT) explains the disease.&lt;br /&gt;&lt;br /&gt;Given what it seems that we know, we  should expect a spectrum of causation to apply, and we think that's  what's been observed.&amp;nbsp; Clearly cancer is a disease of clonal expansion of cells, typically descendants of a single transformed founder cell.&amp;nbsp; The job of cells is to behave--express subsets of the genes in their genome--in ways that suit their local signaling (inter-cellular communication) environment. Gene expression is how this works, so clearly either mutant genes or mistaken interpretation of the environment, can trigger misbehavior.&lt;br /&gt;&lt;br /&gt;First, the SMT, the idea that cancer is entirely due to somatic mutations, should be tempered, because it is manifestly clear that inherited mutations play a role, not just somatic mutations (that occur in body cells but were not inherited from the patient's parents).&amp;nbsp; As an overall generalization, cancers show mutations in many genes, but some of these have been inherited. Typically those are mutations that are 'recessive': if you get one 'bad' copy from one parent, but a good copy from your other parent, you're generally OK, unless you inherit deficient variants at other genes.&amp;nbsp; You get cancer if the good copy is somatically mutated in a cell, as well perhaps as other mutations in other genes or changes in the cellular  environment.&amp;nbsp; Such genes are known as 'antioncogenes' or tumor supressor genes, because on their own they don't cause--and might function to hold back--abnormal cell behavior.&amp;nbsp; These are the main known genes in which inherited mutations lead to cancer. TP53, a gene that encodes the tumor-suppressor protein p53, is an example&lt;span class="Apple-style-span" style="font-family: sans-serif; font-size: x-small;"&gt;&lt;span class="Apple-style-span" style="line-height: 19px;"&gt;.&lt;/span&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: sans-serif; font-size: 13px; line-height: 19px;"&gt;&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;Oncogenes are those than can actively lead a cell astray, 'causing' cancer on their own (probably other factors&amp;nbsp; have to be present as well).&amp;nbsp; Mutations in these genes are rarely inherited, because the affected embryo doesn't make its 0th birthday.&amp;nbsp; If you suffer a somatic mutation in one of these (probably also if the cell has variants in additional genes, or the cell environment is changed somehow), you get cancer.&lt;br /&gt;&lt;br /&gt;In either case, SMT argues that somatic mutations must contribute because, after all, you are born normal which means your inherited genotype didn't prevent proper tissue differentiation when you were an embryo. Debate was about how many or what or what types of genes were mutated somatically before someone got cancer. The age and rate of onset (age-specific 'hazard' function) seemed to reflect the number of changes that were needed to transform a cell, the number of cells at risk, and their cell-division rate.&lt;br /&gt;&lt;br /&gt;The type of cancer that started us off on the path to the discovery of these aspects of cancer was the rare cancer of the retina (light perceiving layer inside the eye), retinoblastoma, or RB.&amp;nbsp; &lt;a href="http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0002025/"&gt;RB&lt;/a&gt; mainly occurs by birth or in early childhood.&amp;nbsp; It's rare, but one of the most stunning and influential discoveries--a true rather than hyped 'breakthrough'--was made in the early '70s by Al Knudson.&amp;nbsp; He observed that in sporadic RB only one eye was affected and usually with only one primary tumor.&amp;nbsp; But in the rare instance of inherited RB, both eyes were often affected, and by multiple independent tumors.&lt;br /&gt;&lt;br /&gt;The idea struck Knudson that if some gene caused the tumor, then if no mutant copies of this gene were inherited, it would be very unlikely that any given retinal cell would be so unlucky as to experience mutations in both copies of the gene: hence sporadic RB is rare and unsually unilateral.&amp;nbsp; But if one bad copy were inherited, the fetus would only need to 'wait' for the other copy to be hit.&amp;nbsp; In the millions of newly forming retinal cells, it was reasonably likely that one or even many such cells would indeed be hit by another mutation.&lt;br /&gt;&lt;br /&gt;The fact that RB occurred at birth rather than decades later, along with this idea about causation, suggested that there really was only one gene that needed to go bad.&amp;nbsp; By luck, a group involving Bob Ferrell, who was in Houston with Al Knudson (as was yours truly), discovered a chromosome change that was associated with RB in a family or two, and this led to the discovery of the gene, which was named RB1.&lt;br /&gt;&lt;br /&gt;This opened many doors!&amp;nbsp; Knudson is widely honored, though he should in our opinion have been awarded a Nobel prize for his very insightful work (and he's a very nice person to boot!). &amp;nbsp;Anyway, to continue the story of the door he opened, soon other childhood tumors (esp. Wilm's tumor of the kidney) were found to have similar genetic epidemiology.&amp;nbsp; Then others, notably Bert Vogelstein and Ken Kinzler at Johns Hopkins, developed tests to see how often this phenomenon of somatic loss of a good copy of a tumor-suppressor gene occurred in people who had inherited one bad copy.&amp;nbsp; They found evidence that led to the discovery of other tumor suppressor genes, the most famous of which had to do with colon cancer (and the Tp53 gene that's involved in cell behavior).&lt;br /&gt;&lt;br /&gt;Most tumors take decades to develop, even breast cancer in people inheriting mutations in BRCA genes (which is also in the suppressor category).&amp;nbsp; And this knitted tissue environmental factors (such as exposure to things including menstrual cycling and lactation that stimulated breast cell division) with genetic factors.&amp;nbsp; Each patient may have a unique set of many different mutations in other genes, some perhaps inherited others acquired somatically, and these were not terrible in themselves but carcinogenic in combination.&amp;nbsp; The idea of 'waiting' for these events to occur is strengthened by the discovery that BRCA works in a mutation-repair pathway.&amp;nbsp; So if you can't repair mutations, you're more likely to collect a bad set of them in some cell.&lt;br /&gt;&lt;br /&gt;A generally consistent picture emerged, of complex, multifactorial genetic and histological processes that accounted for much of the epidemiology and genetics of cancer.&amp;nbsp; There are many aspects of this picture that require particular study and explanation.&amp;nbsp; It seemed that we had a pretty good understanding of the causal landscape, even if the specifics were complex or elusive.&lt;br /&gt;&lt;br /&gt;But a new paper in &lt;i&gt;Nature&lt;/i&gt; raises questions about even the simple RB model that are challenging to answer, in light of the above ideas.&amp;nbsp; That will be in Part V of this series on the causation of this dreaded disease--and what it tells us about basic cell biology.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-1122366294170398979?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/1122366294170398979/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_20.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1122366294170398979'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1122366294170398979'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_20.html' title='Do we still not know what causes cancer?  Part IV.  The classic case returns....'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2362968108950627164</id><published>2012-01-19T05:01:00.000-05:00</published><updated>2012-01-19T05:01:00.397-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='epidemiology'/><category scheme='http://www.blogger.com/atom/ns#' term='risk'/><category scheme='http://www.blogger.com/atom/ns#' term='probability'/><category scheme='http://www.blogger.com/atom/ns#' term='randomness'/><category scheme='http://www.blogger.com/atom/ns#' term='GWAS'/><category scheme='http://www.blogger.com/atom/ns#' term='personalized medicine'/><title type='text'>Probability does not exist!  Part IV.  Here's to your health!</title><content type='html'>&lt;b&gt;Probability and unique events&lt;/b&gt;&lt;br /&gt;Probability and statistics are very sophisticated, technical, often very mathematical sciences.&amp;nbsp; The field is basically about the frequency of occurrence of different possible outcomes of repeatable events.&lt;br /&gt;&lt;br /&gt;When events can in fact be repeated, a typical use of statistical theory is to estimate the properties of what's being observed and assume, or believe, that these will pertain to future sets of similar observations.&amp;nbsp; If we know how a coin flipped in repeated observations in the past, we extrapolate that to future flips of that coin--or even to flips of other 'similar' coins.&amp;nbsp; If we observe thousands of soup cans coming off an assembly line, and know what fraction were filled slightly below specified weight, we can devise tests for efficiency of the machinery, or methods for detecting and rejecting under-weight cans.&amp;nbsp; And there are countless other situations in which repeatable events are clearly amenable to statistical decision-making.&lt;br /&gt;&lt;br /&gt;When events cannot be or haven't been repeated, a common approach is to assume that they could be, and use the observed single-study data to infer the likely outcomes of possible repetitions.&amp;nbsp; As before, we extend our inference to to new situations in which similar conditions apply. In both truly and singular events there is similar reasoning, regardless of the details about which statisticians vigorously argue.&lt;br /&gt;&lt;br /&gt;Everyone acknowledges that there is a &lt;i&gt;fundamentally &lt;/i&gt;subjective element in making judgments, as we've described in the previous parts of this series of posts.&amp;nbsp; They are called, for example, significance tests from which one must choose a cutoff level or decision level.&amp;nbsp; But in well-controlled, relatively simple, especially repeatable situations, the theory at least provides some rigorous criteria for making the subjective choices.&lt;br /&gt;&lt;br /&gt;The issues become much more serious and problematic when the situation we want to understand is either not replicable, not simple, not well understood, or in which even our idea of the situation is that the probabilities of different possible outcomes are very similar to each other.&amp;nbsp; Unfortunately, these are basic problems in much of biology.&lt;br /&gt;&lt;br /&gt;Like dice, outcome probabilities are &lt;i&gt;estimated &lt;/i&gt;from empirical data--past experience or experiments and finite (limited) samples.&amp;nbsp; Estimation is a mathematical procedure that depends on various assumptions and values, like averages of some measured trait, have measurement error and so on.&amp;nbsp; One might question these aspects of any study of the real world, but the issue for us here is that these estimates rest on some assumptions and are &lt;i&gt;retrospective&lt;/i&gt;, because they are based on past experience.&amp;nbsp; But what we want those estimates for is to predict, that is to use them &lt;i&gt;prospectively.&lt;/i&gt;&lt;br /&gt;&lt;br /&gt;This is perhaps trivial for dice--we want to predict the probability of a 6 or 3 in the next roll, based on our observations of previous rolls.&amp;nbsp; We can be confident that the dice will 'behave' similarly.&amp;nbsp; Remarkably, we can also extrapolate this to other dice fresh from a new pack, that have never been rolled before, but only on the assumption that the new dice are just like the ones our estimates were derived from.&amp;nbsp; We can never be 100% sure, but it seems usually a safe bet--for coin-flips and dice.&lt;br /&gt;&lt;br /&gt;&lt;b&gt;Predicting disease outcomes&lt;/b&gt;&lt;br /&gt;But this is far from the case in genetics, evolution, and epidemiology.&amp;nbsp; There, we know that no two people are genetically alike, no two have exactly the same environmental or lifestyle histories.&amp;nbsp; So that people are not exactly like dice.&amp;nbsp; Further, genes change (by mutation) and environments change, and these changes are &lt;i&gt;inherently &lt;/i&gt;unpredictable as far as is known.&amp;nbsp; Thus, unlike dice, we cannot automatically extrapolate estimates from past experience such as genes or lifestyle factors and disease outcomes, to the future -- or from past observations to you.&amp;nbsp; That is, often or even typically, we simply cannot know how accurate an extrapolation will be, even if we completely believe in the estimated risks (probabilities) that we have obtained.&lt;br /&gt;&lt;br /&gt;And, any risk estimation is inherently elusive anyway because people respond.&amp;nbsp; If you're told your risk of heart disease is 12%, that might make you feel pretty safe and you might stop exercising so much, or add more whipped cream to your cocoa, or take up smoking, but if you're told your risk is 30% you might do the opposite.&amp;nbsp; Plus, there's some thought that heart disease might have an infectious component, and that's never included in risk estimators, and is inherently stochastic anyway.&amp;nbsp; And, if there's a genetic component to risk, that can vary  to the extent that many families might have an allele unique to them, which can't be included in the model because models are built on prior observations that won't apply to that family.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;A second issue is that even if the other things are orderly, in genetics and epidemiology and trying to understand natural selection and evolution, we are trying to understand outcomes whose respective probabilities are usually small and usually very similar.&amp;nbsp; As we've tried to show with the very similar (or identical?) probabilities of Heads vs Tails, or of 6 vs 3 on a die, this is very difficult even in highly controlled, easily repeatable situations.&amp;nbsp; But this simply is often not nearly the case in biology.&lt;br /&gt;&lt;br /&gt;Here the risks of this vs that genotype, at many different genes simultaneously, are very indivdually small and similar, and that's why GWAS requires large samples, often gets apparently inconsistent results from study to study, accounts for small fractions of heritability (the &lt;i&gt;estimated&amp;nbsp; &lt;/i&gt;overall genetic contribution).&amp;nbsp; This means that it is very difficult to identify genetic contributions that are statistically significant--that have strong enough effects to pass some subjective decision-making criterion.&lt;br /&gt;&lt;br /&gt;This means it's very difficult to estimate a statistically reliable risk probability to persons based on their genotype, and certainly makes it difficult to assign a &lt;i&gt;future &lt;/i&gt;risk. Or to know whether each person with that genotype has the same risk as the average for the group.&amp;nbsp; That is why many of us think that the current belief system, and that's what it is!, in personalized genomic medicine, is going to cost a lot for relatively low payoff, compared to other things that can be done with research funds---for example, to study traits that really are genetic: for which the risk of a given genotype is so great, relative to other genotypes, that we can reliably infer causation that is hugely important to individuals with the genotype, and for which the precision of risk estimates is not a big issue.&lt;br /&gt;&lt;b&gt;&lt;br /&gt;&lt;/b&gt;&lt;br /&gt;&lt;b&gt;Probabilities and evolution&lt;/b&gt;&lt;br /&gt;Similarly, in reconstructing evolution, if the differences among contemporary genotypes in terms of adaptive (reproductive) success are very similar, the actual success of the bearers of the different genotypes will be very similar, and these are probabilities (of reproduction or survival).&amp;nbsp; And if we want to estimate selection situations in the distant, unobserved past, from net results we see today, the problems are much more challenging even if we thoroughly believe in our theories about adaptive determinism or genetic control of traits.&amp;nbsp; Past adaptation also occurs, usually we think, very slowly over many many generations, making it very difficult to apply simple theoretical models.&amp;nbsp; Even to look for contemporary selection, other than in clear situations such as the evolution of antibiotic or pesticide resistance, is very challenging.&amp;nbsp; Selective differences must be judged only from data we have today, and directly observing causes for reproductive differences in the wild today is difficult and requires sample conditions rarely achievable.&amp;nbsp; So naturally it is hard to detect a pattern, hard to make causal assertions that are more than storytelling.&lt;br /&gt;&lt;b&gt;&lt;br /&gt;&lt;/b&gt;&lt;br /&gt;&lt;b&gt;And, finally&lt;/b&gt;&lt;br /&gt;We hope to have shown in this series of posts why we think we have to accept that 'probability' is an elusive notion, often fundamentally subjective and not different from 'belief'.&amp;nbsp; We set up criteria for believability (statistical significance cutoff values) upon which decisions--and in health, lives--depend.&amp;nbsp; The stability of the evidence and vagaries of cutoff-criteria, and our often reluctance to accept results we don't like (treating evidence that doesn't pass our cutoff criterion but is close to it as 'suggestive' of our idea rather than rejecting our idea), all conspire to raise very important issues for science.&amp;nbsp; The issues have to do with allocation of resources, egos, and other vested interests upon which serious decisions must be made. &lt;br /&gt;&lt;br /&gt;In the end, causation must exist (we're not solopsists!), but randomness and probability may not exist other than in our heads.&amp;nbsp; The concept provides a tool for evaluating things that do exist, but in ways that are fundamentally subjective.&amp;nbsp; But we are in such a hurry in the system of science and its use that has evolved that we are not nearly humble enough in regard to what we know about what we don't know.&amp;nbsp;&amp;nbsp; That is a fact that exists, whether probability does or not!&lt;br /&gt;&lt;br /&gt;It is for these kinds of reasons that we feel research investment should concentrate on areas where the causal 'signal' is strong and basically unambiguous--traits and diseases for which a specific genetic causation is much more 'probable' than for the complex traits that are soaking up so many resources.&amp;nbsp; Even the 'simple' genetic traits, or simple cases of evolutionary signal, are hard enough to understand.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2362968108950627164?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2362968108950627164/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-iv.html#comment-form' title='6 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2362968108950627164'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2362968108950627164'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-iv.html' title='Probability does not exist!  Part IV.  Here&apos;s to your health!'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>6</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-461657521690725925</id><published>2012-01-18T05:39:00.000-05:00</published><updated>2012-01-18T05:39:00.445-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='probability'/><category scheme='http://www.blogger.com/atom/ns#' term='randomness'/><title type='text'>Probability does not exist. Part III.  Making the call...</title><content type='html'>We continue a discussion of randomness, probability, and scientific inference.&amp;nbsp; We made some points in the first two installments about the elusive and subjective aspects of probability.&amp;nbsp; Here we'll ask a few similar kinds of questions, and then (finally!) get to the relevance for genetics and evolution and other areas like epidemiology.&lt;br /&gt;&lt;br /&gt;What does it mean to say that a phenomenon is 'random'?&amp;nbsp; This is a rather subjective terms, but intuitively it means that nothing in a test or experiment affects the particular outcome.&amp;nbsp; If dice are thrown randomly, it means that nothing about the throw affects whether a 1 or 6 will come up.&amp;nbsp; More generally, dice throws would be said to be random events because each toss leaves each face equally likely to occur.&amp;nbsp; Equally likely is a rather circular term, but it implies again that each side comes up the same fraction of the time.&lt;br /&gt;&lt;br /&gt;Many events are said to be random or probabilistic with the unstated assumption that the event is &lt;i&gt;inherently &lt;/i&gt;random.&amp;nbsp; That there is no process that makes the outcome specifically predictable.&amp;nbsp; Quantum mechanics, to many people, are like that: the position of an electron around an atom is inherently probabilistic.&amp;nbsp; No matter how much information or perfect measurement we might have, the electron's position is only predictable in a probabilistic sense (forgive us, any physicist readers, if we're not well-enough informed to have described this properly!).&lt;br /&gt;&lt;br /&gt;Other things are said to be 'random' in that while they might be deterministic, we simply can't tell the difference between that and a truly probabilistic process.&amp;nbsp; Dice rolling is generally viewed that way--as fundamentally random.&amp;nbsp; We saw in the previous installments that this can be modified in a way.&amp;nbsp; A six and a one may not have exactly the &lt;i&gt;same &lt;/i&gt;probability of coming up on a given roll, but once we know their side-specific probability, the process is random relative to that.&amp;nbsp; If a 6 has prob. 0.168 and a 1 has prob 0.170 of coming up, those will be the fractions we'd observe, but cannot predict any more accurately than that.&lt;br /&gt;&lt;br /&gt;Coin-flipping is a classic example of supposedly truly probabilistic events.&amp;nbsp; But is it?&amp;nbsp; Flipping coins lots of times never generates &lt;i&gt;exactly &lt;/i&gt;50% heads and 50% tails, the kind of discrepancy seen in dice.&amp;nbsp; But is the discrepancy we observe just experimental error of random processes, or is there a true bias--does one side 'really' have a higher chance of coming up roses?&amp;nbsp; Is coin-flipping a truly random process, or do we just not know enough to predict the outcome of a flip?&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://4.bp.blogspot.com/-BPtDTeGHj1E/Tw3FXV_cmvI/AAAAAAAAAI8/BWOBrOuGMMM/s1600/CoinFlipper.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="234" src="http://4.bp.blogspot.com/-BPtDTeGHj1E/Tw3FXV_cmvI/AAAAAAAAAI8/BWOBrOuGMMM/s320/CoinFlipper.png" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;Here is a device developed a few years ago for a Stanford statistics professor named Persi Diaconis (who has special interests in the mathematics of gambling, magic, and things like that).&amp;nbsp; He has studied coin-flipping in practical as well as theoretical terms.&amp;nbsp; He has shown that if you set up the flip in the same way every time, you will get the same outcome every time -- that is, the outcome is entirely predictable.&amp;nbsp; Put this in other terms, as he has done in his &lt;a href="http://comptop.stanford.edu/u/preprints/heads.pdf"&gt;paper &lt;/a&gt;on the subject, coin flipping is basically a standard physics phenomenon, that obeys the essentially deterministic laws of physics.&amp;nbsp; If you know all the relevant values about the coin, the flipping force and direct, the landing surface, and so on, the outcome is entirely predictable.&lt;br /&gt;&lt;br /&gt;The reason outcomes seem 'random' is that there are so many things we don't know about a given flip, and so many differences from flip to flip, that we generally don't know enough to predict the outcome.&amp;nbsp; That is, they seem truly probabilistic.&amp;nbsp; But in a sense they are instead truly deterministic.&lt;br /&gt;&lt;br /&gt;Diaconis and his co-authors analyzed the various factors, in classical physics terms, and to control for them and as we understand their result, they concluded that at least for their test coin, there was a 51% probability that the side that was up when flipped will come up at the end.&amp;nbsp; Flipping is somehow, and subtly, biased.&lt;br /&gt;&lt;br /&gt;We make the call on coin-flipping at the beginning of a football game or to see who&amp;nbsp; pays for the next round of drinks, or who draws the short straw and has to do an unpleasant job.&amp;nbsp; We think of these as random.&amp;nbsp; But if we're skeptical, how do we make the call on that question itself?&amp;nbsp; Here, despite all of the above, and relevant to the entire nature of probabilistic-seeming events and understanding them, belief and subjectivity inevitably enter the room...whether or not their entrance is announced.&lt;br /&gt;&lt;br /&gt;That's because at some point we have to decide whether the results (51% that the starting upside will be the ending upside) really do mean something in themselves, or are just the fluke results of a finite number of observations whose outcomes could be the way we see them 'just by chance'.&amp;nbsp; Even the latter phrase is circular and vague.&amp;nbsp; In the end, we decide what it takes for us to 'believe' one interpretation over another.&amp;nbsp; And there is no objective way to decide what we should believe: everyone has to make that call for him or herself!&lt;br /&gt;&lt;br /&gt;If we see a situation in which different possible outcomes have very different probabilities--arise with very different fractions of the time--these issues may not arise.&amp;nbsp; We'd all agree on the general interpretation.&amp;nbsp; We share our beliefs.&amp;nbsp; Even with unique events, the assumption of probability that relates to the fraction of outcomes of each sort &lt;i&gt;if &lt;/i&gt;the event could be repeated, is not a serious issue: results more or less bear out what we think we would see in repeated tests.&amp;nbsp; Or if we have seen a few repetitions of an event, we can be confident that we understand the relative probabilities of the outcomes.&lt;br /&gt;&lt;br /&gt;But we've given a few examples of experiments to try to show how subtle and elusive concepts like randomness and probability are, even for the simplest and most controllable kinds of situations.&amp;nbsp; These are ones in which the probability differences among outcomes (heads vs tails, faces of dice) are very small (nearly 50% heads, 50% tails, 1/6 for each die face).&lt;br /&gt;&lt;br /&gt;The reason for this is that in many situations in biology, including attempts to understand the relationship between genes and traits (e.g., GWAS, personalized medicine) or attempts to detect evidence of natural selection from gene sequences, the situation is more like dice:&amp;nbsp; things seem to be probabilistic--perhaps inherently so, and the probability differences between different outcomes, even according to our genetic and evolutionary theories, are very small.&amp;nbsp; Similar situations arise in epidemiology, as we've written often in MT, such as whether PSA testing improves prostate cancer outcomes, or vitamin supplements improve health, and so on.&lt;br /&gt;&lt;br /&gt;That is, we're trying to detect small probabilistic needles in haystacks.&amp;nbsp; And, to a considerable extent, even according to the theory of those doing the studies and claiming to have found the evidence, the events are &lt;i&gt;not&lt;/i&gt; repeatable.&amp;nbsp; In part IV of this series, we'll discuss these in more specific terms, in relation to the issues in the first 3 parts.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-461657521690725925?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/461657521690725925/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-iii.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/461657521690725925'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/461657521690725925'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-iii.html' title='Probability does not exist. Part III.  Making the call...'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/-BPtDTeGHj1E/Tw3FXV_cmvI/AAAAAAAAAI8/BWOBrOuGMMM/s72-c/CoinFlipper.png' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-1201841653955667540</id><published>2012-01-17T05:57:00.001-05:00</published><updated>2012-01-17T14:55:16.381-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='probability'/><category scheme='http://www.blogger.com/atom/ns#' term='randomness'/><title type='text'>Probability does not exist. Part II.  Some 'random' thoughts.</title><content type='html'>In &lt;a href="http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-i-very.html"&gt;Part I&lt;/a&gt; of this series we described the vagueness of the notion of probability.&amp;nbsp; It's an uncertain tangle of concepts that seem obvious but are almost impossible to define.&amp;nbsp; If you doubt that, go look for yourself on the web for terms like probability, chance, or random.&lt;br /&gt;&lt;br /&gt;The terms are defined in circular ways (random means haphazard or due to chance) or in terms of events that were repeated, or that might be repeated in the future, or the fraction of those events with some particular property, or even of events that may not in fact occur or even be possible.&amp;nbsp; Or in terms of what might 'possibly' (another vague term) happen in the future.&amp;nbsp; Or how convinced we may be that it &lt;i&gt;will &lt;/i&gt;happen.&lt;br /&gt;&lt;br /&gt;Probability and statistics are at the very foundation of modern science.&amp;nbsp; But as specialists know and confess readily, the central terms are vague and in a formal sense, axiomatic.&amp;nbsp; You define a probability as a number between 0 and 1 that represents something related to the concepts mentioned in the previous paragraph.&amp;nbsp; An axiom is accepted and used, but not directly tested and need even not be a part of the real world.&amp;nbsp; 2+2=4 is loaded with such kinds of assumptions.&lt;br /&gt;&lt;br /&gt;Probability seems so deeply embedded, and just plain obvious, that it's hard to accept that its use and real-worldliness can be boiled down to beliefs or to something that we just take for granted rather than test.&amp;nbsp; Even something as simple as rolling dice shows the issues, and they're important because they are seen all over the place in human and evolutionary genetics.&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-JvZA0qwAsmM/Tw2yFe-OPCI/AAAAAAAAAIc/Qt7woHTvHuY/s1600/6dice.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="121" src="http://1.bp.blogspot.com/-JvZA0qwAsmM/Tw2yFe-OPCI/AAAAAAAAAIc/Qt7woHTvHuY/s320/6dice.png" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;&lt;br /&gt;&lt;div style="direction: ltr; margin-bottom: 0pt; margin-top: 0pt; text-align: left; unicode-bidi: embed; vertical-align: baseline;"&gt;From:&amp;nbsp; &lt;a href="http://www.maa.org/mathland/mathtrek_10_26_98.html"&gt;Ivar Peterson's &lt;b&gt;Math Trek&lt;/b&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;Let's look at some tests done with dice.&amp;nbsp; Here are results from a web site tallying the rolling of 10,000 dice.&amp;nbsp; Now, the natural reaction is to assume that the spots on each face make no difference to whether it will end on top on a given roll.&amp;nbsp; Somehow we naturally then assume that in 10,000 roles we expect 1667 occurrences of each face. This was not always an obvious expectation, but it has been since WRF Weldon rolled 26,306 dice in 1894, which led to the still-current way we interpret such results.&lt;/div&gt;&lt;br /&gt;Clearly, the expected result is not what happened!&amp;nbsp; Does this--the &lt;i&gt;actual&lt;/i&gt; results, not anything 'theoretical'--then mean that the dice are biased in some way?&amp;nbsp; Nowadays we would all be unclear until we do some kind of statistical test.&amp;nbsp; Following what Karl Pearson developed from Weldon's experiments, we compare the above results with 1667 for each face and say yes, the two are different, but ask &lt;i&gt;how&lt;/i&gt; different and whether it matters.&amp;nbsp; We use some &lt;i&gt;subjective&lt;/i&gt; goodness-of-fit test cutoff level to evaluate the difference, such as are routine in science and taught in basic statistics courses.&lt;br /&gt;&lt;br /&gt;If the subjective cutoff is exceeded, then we say that if our idea that, for whatever reason, each face should come up an equal number of times, the results are unusual enough that we doubt our idea.&amp;nbsp; A typical cutoff would be that if the difference would be as great as what we see in less than one experiment out of 20 experiments, we say our idea is not acceptable.&amp;nbsp; Note that this is purportedly a scientific approach, and science is supposed to be objective, but this is a wholly subjective choice of cutoff, &lt;i&gt;and &lt;/i&gt;it assumes a lot of other things about the data (such as there was no cheating, each toss was done the same way, and so on).&amp;nbsp; Weldon's dice also seemed unfair, but in unclear ways, if one thinks of the possible reasons for unfairness.&amp;nbsp; They even wondered if one of the assistants doing the rolling might have done it differently.&lt;br /&gt;&lt;br /&gt;This seems strange. We might decide that the dice are unfair in this subjective way, though that doesn't tell us &lt;i&gt;how &lt;/i&gt;or why they're unfair.&amp;nbsp; But in another sense, the differences are numerically so small that we might say 'who cares?'&amp;nbsp; (Las Vegas gambling houses care!)&lt;br /&gt;&lt;br /&gt;But notice something: on dice, the spots on opposite sides total to 7.&amp;nbsp; Thus one side has more spots than the opposing one.&amp;nbsp; For example, 1679 sixes vs 'only' 1654 ones.&amp;nbsp; This is true for all such pairs, even if the individual differences don't seem startlingly great.&amp;nbsp; But the above data suggest that since the spots are really dips in the surface of normal dice, they take some mass away so that the weight of the dice is shifted from dead center towards the heavier (fewer spot) side.&amp;nbsp; The more spots the lighter and the more often it comes up.&amp;nbsp; Bingo!&amp;nbsp; A physical explanation for an otherwise curious result!&amp;nbsp; (I understand that spots on Vegas dice are filled with black material of the same type as the rest of the die).&lt;br /&gt;&lt;br /&gt;The significance test that led us to this decision does not imply that the next 10,000 throws of these same dice would come up the same, but the usual thing in science would be (1) stick to the fairness belief and ignore the result, assuming that the next result would be 'better', or (2) adjust the expectations from 1/6th for each side to these observed fractions, and then test the next experiment against these expectations.&lt;br /&gt;&lt;br /&gt;&lt;a href="http://1.bp.blogspot.com/-w4QCMMCqAP8/Tw26ma5poiI/AAAAAAAAAI0/I5gfyTblu90/s1600/DiceMachine.png" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="200" src="http://1.bp.blogspot.com/-w4QCMMCqAP8/Tw26ma5poiI/AAAAAAAAAI0/I5gfyTblu90/s200/DiceMachine.png" width="124" /&gt;&lt;/a&gt;Sounds good, and in fact someone has tried this kind of thing.&amp;nbsp; Here is a machine that mechanically flips dice (see Z. Labby, &lt;i&gt;Chance&lt;/i&gt;, 2009).&amp;nbsp; The developer replicated Weldon's 26,306 throws of 12 dice.&amp;nbsp; No personal assistants, who might be subtly biased, involved!&amp;nbsp; The results are shown in this graph.&amp;nbsp; What you can see is that the previous 'pattern'&amp;nbsp; is not clear here.&amp;nbsp; It is ambiguous from the usual statistical testing whether these dice are biased or not--again, a subjective evaluation.&amp;nbsp; So what do we make of this?&amp;nbsp; We had a&amp;nbsp; physical model, but it wasn't borne out.&amp;nbsp; Was it wrong?&lt;br /&gt;&lt;br /&gt;&lt;a href="http://2.bp.blogspot.com/-eBiiR-W9bns/Tw2yWQTN_DI/AAAAAAAAAIs/CHniHOYpuh4/s1600/NewRoll.png" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"&gt;&lt;img border="0" height="113" src="http://2.bp.blogspot.com/-eBiiR-W9bns/Tw2yWQTN_DI/AAAAAAAAAIs/CHniHOYpuh4/s200/NewRoll.png" width="200" /&gt;&lt;/a&gt;You can argue that the 3 experiments used different ways of tossing dice, or the dice were made&amp;nbsp; years apart and may be of different composition, and whatever else you can think of.&amp;nbsp; Or, you can say that this is a tempest in a teapot because these results are not &lt;i&gt;very &lt;/i&gt;different from each other.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;Note here that there are ways to establish ranges around our observed results that represent what might have occurred&amp;nbsp; had the same dice been rolled the same number of times again (the brackets in the figure, for example, show this).&amp;nbsp; But one has to choose the limits subjectively.&amp;nbsp; The brackets would not be identical from experiment to experiment.&lt;br /&gt;&lt;br /&gt;Even if you said that the results are not very different from each other, do you mean that they are not very different from 1/6 for all faces, or from the biased probabilities of the 10,000-roll experiment?&amp;nbsp; Or from some other type of bias?&amp;nbsp; Should you have a different amount of bias favoring the 6 from that of the 5 and the 4 (the lighter of their respective face-pairs)?&lt;br /&gt;&lt;br /&gt;If this were something whose outcome affected you personally, you likely would say it doesn't matter, if you were playing Monopoly or shooting dice with friends.&amp;nbsp; But if you're the MGM Palace in Las Vegas, you would care much more, because there what counts, so to speak, is not the money made or lost by individuals but by your entire customer base. That can be a very big difference!&lt;br /&gt;&lt;br /&gt;One last thought here.&amp;nbsp; The idea that we should expect each face to come up 1/6 of the time rests on the concept of 'randomness'.&amp;nbsp; But that is an idea so elusive one can ask what it actually means.&amp;nbsp; Normally the idea is that each die face is the same, and so there is 'no reason' any one should come up more often than another.&amp;nbsp; That is essentially unprovable and very likely untrue.&amp;nbsp; But at least, especially in Vegas dice with filled-in pips, the faces of a die are (if fairly manufactured etc. etc.!!) so similar that our intuitive concept is probably not so bad.&amp;nbsp; We were going to say that, after all, most such things do come up more or less as expected....but we hesitated, because we'd have expected that with dice, too!&lt;br /&gt;&lt;br /&gt;The same problems and infuriating (or intriguing) issues arise in something so simple as coin-tossing and asking whether a coin is biased.&amp;nbsp; Normally we would consider it, like dice, to be a 'random' phenomenon and that's why heads and tails come up the same fraction of the time (if they do!).&amp;nbsp; This raises other fundamental questions, as we'll see in Part III.&amp;nbsp; There, we'll show how very relevant all of this is to human medical genetics, studies like GWAS, and to the inferences we make about evolution.&lt;br /&gt;&lt;div style="direction: ltr; margin-bottom: 0pt; margin-top: 0pt; text-align: left; unicode-bidi: embed; vertical-align: baseline;"&gt;&lt;span style="color: black; font-family: Arial; font-size: 12pt; font-weight: bold;"&gt; &lt;/span&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-1201841653955667540?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/1201841653955667540/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-ii-some.html#comment-form' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1201841653955667540'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1201841653955667540'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-ii-some.html' title='Probability does not exist. Part II.  Some &apos;random&apos; thoughts.'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-JvZA0qwAsmM/Tw2yFe-OPCI/AAAAAAAAAIc/Qt7woHTvHuY/s72-c/6dice.png' height='72' width='72'/><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-1988217960879474921</id><published>2012-01-16T05:23:00.001-05:00</published><updated>2012-01-16T05:23:00.113-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='heritability'/><category scheme='http://www.blogger.com/atom/ns#' term='missing heritability'/><category scheme='http://www.blogger.com/atom/ns#' term='gene interactions'/><category scheme='http://www.blogger.com/atom/ns#' term='additive models'/><category scheme='http://www.blogger.com/atom/ns#' term='epistasis'/><category scheme='http://www.blogger.com/atom/ns#' term='genetic architecture'/><category scheme='http://www.blogger.com/atom/ns#' term='GWAS'/><title type='text'>Changing the goal posts: heritability lost and found</title><content type='html'>We interrupt our series on Probability and its meaning, for a post that we've been asked to write, related to a new paper on gene hunting that got some press last week, and will be stirring up controversy (and naturally, we can't resist including our usual editorializing, for better or worse):&lt;br /&gt;&lt;br /&gt;&lt;b&gt;Making complexity simple (again)?&lt;/b&gt;&lt;br /&gt;Every age and every profession has its PT Barnums.&amp;nbsp; They're the slick-talking, fast-moving guys who will say anything to draw customers into the show they're running.&amp;nbsp; Truth, if it even exists other than ambiguously, is secondary in many ways to closing the deal.&lt;br /&gt;&lt;br /&gt;One tactic that the pitchmen use in fields like politics is to change definitions so that problems never get 'solved' (that is, there is always something to keep you in office or to keep levying taxes, or to keep you afraid of some enemy or other).&amp;nbsp; This is a way of making the same facts serve new interests.&lt;br /&gt;&lt;br /&gt;Science is rife with these kinds of self-interested maneuvers.&amp;nbsp; Changing the goalposts in genetics means redefining the objectives or the criteria for pushing ahead even in the face of contrary evidence. &amp;nbsp;This is a system we've built, step by step, once government funding largesse started flowing some time during the Cold War.&amp;nbsp; And today, in genetics, which plays on fear of death just as much as preachers do, we have to keep passing the plate.&amp;nbsp; Yet science is supposed to be objective and 'evidence based'.&amp;nbsp; So we have to change the goalposts to keep the game from ending.&amp;nbsp; In this case, there is a recent &lt;a href="http://www.pnas.org/content/early/2012/01/04/1119675109.full.pdf+html"&gt;paper&lt;/a&gt;, with promise of more to come, by Eric Lander and colleagues (Zuk et al.).&amp;nbsp; Because of his prominence, skill, and salesmanship this will of course get a lot of attention.&lt;br /&gt;&lt;br /&gt;The paper discusses at least one reason why GWAS have not been very good at accounting for heritability (something we ourselves have commented on in many posts).&amp;nbsp; Some, who are critical, say that this paper finally shows that GWAS and related big-scale approaches are proliferating even though they have themselves shown that they've reached diminishing returns.&amp;nbsp; &lt;a href="http://independentsciencenews.org/health/phantom-heritability-indicates-poor-predictive-value-of-gene-tests/#more-689"&gt;Here's&lt;/a&gt; an example. &amp;nbsp;Of course there's the &lt;a href="http://www.bbc.co.uk/news/health-16347116"&gt;resistance&lt;/a&gt; that says no, Bravo! to the new paper, which shows that we're just getting started!&lt;br /&gt;&lt;br /&gt;Naturally, everyone shares an interest in saying that to show their favorite view we need mega-GWAS, Biobank, gobs of wholegenome sequence, or other similar open-ended approaches, and whether this will lead to the ultimate &lt;i&gt;small &lt;/i&gt;scale objective of personalized 'genomic' medicine.&amp;nbsp; Far too many vested interests are at play and, indeed, training in 'grantsmanship' and the whole research culture is about manipulating the system to get, keep, and increase funding.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;&lt;a href="http://2.bp.blogspot.com/-uY1Ceon29VI/TxNc-tOgXaI/AAAAAAAACO8/tTDesImzsHg/s1600/File-Alice+05a-1116x1492.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="200" src="http://2.bp.blogspot.com/-uY1Ceon29VI/TxNc-tOgXaI/AAAAAAAACO8/tTDesImzsHg/s200/File-Alice+05a-1116x1492.jpg" width="149" /&gt;&lt;/a&gt;Zuk et al. ask why GWAS have failed to account for the heritability of so many traits, that is, to explain the correlation in risk among family members that reflects genetic effects.&amp;nbsp; The subject is complex, but here we can just say that if each gene adds a dose of effect to a trait, like nibbles on a given side of the caterpillar's mushroom added to Alice's stature, then even if the effect of nibbles is very small, if we sample enough mushrooms we can identify all of the effects.&amp;nbsp; Then, knowing them, we can tell which nibbles a given person has made, and hence predict his stature:&amp;nbsp; &lt;i&gt;Voila!&lt;/i&gt;&amp;nbsp; personalized medicine!&lt;br /&gt;&lt;br /&gt;Yet it hasn't worked that way.&amp;nbsp; Most heritability remains unaccounted for despite already very large studies.&amp;nbsp; Hence the demand for ever larger studies.&amp;nbsp; A glib &lt;a href="http://www.nature.com/nature/journal/v461/n7265/abs/nature08494.html"&gt;commentary&lt;/a&gt; in &lt;i&gt;Nature&lt;/i&gt; a few years ago coined the term 'hidden heritability' and made the search to find it akin to Sherlock Holmes' search for Moriarty.&amp;nbsp; That was a fantastic, if anti-science, marketing ploy on &lt;i&gt;Nature&lt;/i&gt;'s part, since it fed an ever-increasing demand for funds for genomic scavenger hunting....and that's good for the science journal business!&lt;br /&gt;&lt;br /&gt;But the search for this hidden treasures has been frustrating, and Zuk et al. claim they now know that the search is in vain, and they provide a very sophisticated mathematical account of the reason why.&amp;nbsp; It is due to gene interactions, or 'epistasis'.&amp;nbsp; That means that a large part of the correlation among relatives can't be found by looking only for additive effects.&amp;nbsp; Here's roughly a basic underlying concept:&lt;br /&gt;&lt;br /&gt;If trait T, such as stature or insulin levels (or their disease-risk consequences) is due to the effects of factor A plus those of factor B, then we can write&lt;br /&gt;&lt;br /&gt;T = A + B&lt;br /&gt;&lt;br /&gt;If your genotype includes a variant A-gene that gives you an additional level of factor A, then for you&lt;br /&gt;&lt;br /&gt;T = A + A + B,&amp;nbsp;&amp;nbsp; or 2A + B.&lt;br /&gt;&lt;br /&gt;But if the factors &lt;i&gt;interact&lt;/i&gt;, say in a multiplicative way, then&lt;br /&gt;&lt;br /&gt;T = AxB&lt;br /&gt;&lt;br /&gt;and if that's what's going on, and your A-gene genotype adds a second dose of A, your trait is&lt;br /&gt;&lt;br /&gt;T = (2A) x B =&amp;nbsp; 2AB&lt;br /&gt;&lt;br /&gt;So, let's say a normal person has A=3 trait units and B=4 trait units.&amp;nbsp; In the additive case that person's trait would be A+B=7.&amp;nbsp; And if you have a mutation that doubles your A-dose, then your genotype makes you 2A+B=10 for your trait value.&amp;nbsp; But in the epistasis case, your trait would actually be 24.&amp;nbsp; So we expect you to have trait value 10, and conclude that more than half your trait value is unexplained.&lt;br /&gt;&lt;br /&gt;&lt;b&gt;Functional interaction&lt;/b&gt;&lt;br /&gt;Nobody disputes a central fact in the Zuk et al. argument.&amp;nbsp; Life works by interactions among genes.&amp;nbsp; These are functional interactions in systems called 'networks' and other sorts of molecular interactions.&amp;nbsp; One molecule doesn't do anything by itself, nor does one gene as a rule.&amp;nbsp; Here, each gene-related component is subject to variation by mutation, and that will be inherited (its effects contributing to heritability).&amp;nbsp; So it is obvious from a cell biology point of view that single-factor explanations are not going to tell the whole story. But the fact of multiple factors doesn't tell the story we're interested in predicting states among variable traits.&amp;nbsp; That involves a different kind of interaction.&lt;br /&gt;&lt;br /&gt;&lt;b&gt;Quantitative interaction&lt;/b&gt;&lt;br /&gt;If the true-fact is that biological traits are the result  of functional interactions, what epidemiological risk estimation is about is not a list of pathways but the  effects of &lt;i&gt;variation&lt;/i&gt; in the pathways. When factors interact in a non-additive way, their net result is estimated from sample data using statistical techniques.&amp;nbsp; The A B example above showed conceptually how they work.&amp;nbsp; The additive contributions of variants in factor A are estimated from samples that compare those with and those without the variant in question.&amp;nbsp; You can estimate each factor's effects independently in this way and add up the estimates.&lt;br /&gt;&lt;br /&gt;But if they interact, then&amp;nbsp;in essence&amp;nbsp;you have to have an additional estimate to make, of the average trait value in groups of people with each &lt;i&gt;combination&lt;/i&gt; of the variants at the interacting factors.&lt;br /&gt;&lt;br /&gt;Not only does this require more data, it won't show up in GWAS types of case-control or similar data.&amp;nbsp; You need to look in other ways.&lt;br /&gt;&lt;br /&gt;Zuk et al. address this.&amp;nbsp; They build their idea that much of the observed heritability is estimated on a purely additive model, and yet at least some factors may be what in standard biochemical terms is known as 'rate limiting' effects.&amp;nbsp; At some level of concentration of such factors, they or what they interact with no longer works the same way if it works at all.&amp;nbsp; The authors outline a model which, under various assumptions about how many steps are rate-limiting such that variants in those steps define measures of heritability, might begin to explain familial correlations not accounted for by current additive effects. &lt;br /&gt;&lt;br /&gt;It is already nigh impossible to get stable estimates of hundreds of  additive effects, mostly very small (see our current series of posts on &lt;i&gt;Probability does not exist&lt;/i&gt;!).&amp;nbsp;  It's one thing to estimate the effects of, say, 100 additively  contributing genes. Variants will be many in each, variable in their frequencies among samples.&amp;nbsp; If purely additive, the context doesn't matter: in each population you can estimate each factor's effect and add 'em up to get a given person's risk.&amp;nbsp; But if &lt;i&gt;context&lt;/i&gt; matters, that is, if the effect of one factor depends on the specific variants in the rest of the genome (forgetting environmental effects!) then it's quite another to estimate those interactions.&amp;nbsp; Roughly, if 100 genes interact in pairwise fashion (2-way  interactions like AxB only), that means 10,000 interaction effects to  estimate. Zuk et al. certainly acknowledge this problem clearly.&amp;nbsp; But the authors suggest kinds of data on relatives of various degrees that might be practicably collected and could reveal discrepancies from expectations under  additive models, and account for more or all of the heritability.&lt;br /&gt;&lt;br /&gt;Zuk et al. promise that if we study 'isolated' populations we'll have a shot at the answer!&amp;nbsp; This is not new, and indeed studies in Finland and Iceland led a previous charge for similar reasons.&amp;nbsp; Perhaps it is a good idea....and the authors provide tests that could be done if there were adequate data collected.&amp;nbsp; It will be done and will expend more millions of research dollars in the process. &amp;nbsp;But, if complexity is real, the most we'll get is a few hits and a few weak statistical signals.&amp;nbsp; But we're in that place already, so in that sense this is another way of changing the goalposts, because we did not reap bonanza from those studies.&lt;br /&gt;&lt;br /&gt;&lt;b&gt;The answer&lt;/b&gt;&lt;br /&gt;Like most such papers, Zuk et al. make gobs of assumptions about the model, the data, and the underlying basis of dichotomous disease (present or absent).&amp;nbsp; Facing such complex problems it's hard or impossible not to make simplifying or exemplifying assumptions.&amp;nbsp; As usual, if one probes these assumptions, there will be additional sources of variation and uncertainty that are being ignored or that must be estimated from data, so that even the rosy answers suggested by the authors, which are far from promising a complete understanding, will be overstated (and that is the clear-cut history of the senior author, and most of his peers in the profession, including Francis Collins).&lt;br /&gt;&lt;br /&gt;The actual answer is well known, even if it's resisted because it's not very convenient: life is a mixture, or spectrum, of all of these kinds of components.&amp;nbsp; We know that additive models work very well in many domains, such as agricultural and experimental breeding (artificial selection), and that as GWAS sample sizes have increased steadily they have steadily been identifying more contributing genes.&amp;nbsp;&amp;nbsp; That is, we have not plateaued to a point that bigger samples will not add more genes, the remaining recalcitrant effect due to interaction.&amp;nbsp; We think even the authors acknowledge that the interactions may comprise sets of individually weak contributors. &lt;br /&gt;&lt;br /&gt;Further, because most variants in our population are in fact, and indisputably, rare to very rare, they form a large aggregate of potentially contributing genes that will vary from sample to sample and population to population.&amp;nbsp; This is, really, a fact of life.&lt;br /&gt;&lt;br /&gt;Networks, the&amp;nbsp; sugar plum fairies of promised genomic medical miracles, involve tens of genes, many with multi-way interactions, like AxBxC. And what of higher-order interactions such as the square of one or more factor levels?&amp;nbsp; One might as well count stars in heaven as attempt to collect accurate data from the entire human species in order to get enough data to estimate these effects.&amp;nbsp;&amp;nbsp; And that, of course, is foolish for many reasons, not least being that environmental factors change and vary and heritability is a measure of genetic relative to environmental effects.&lt;br /&gt;&lt;br /&gt;Zuk et al. are promising a series of papers along this track,  and have coined a new name for their idea (a standard marketing ploy). We'll be hearing a lot of me-tooism, users avidly diving  into the LP (limiting pathway) model.&amp;nbsp; That certainly doesn't make the  model wrong, but it does affect where the goalposts are. We're hopefully not hypocrites: we have our own simulation program, called &lt;a href="http://bioinformatics.oxfordjournals.org/content/24/16/1821.abstract"&gt;ForSim&lt;/a&gt; (freely available to others) by which some of these things could be simulated, and we may do that.&lt;br /&gt;&lt;br /&gt;Nobody can seriously question that context is very important, and that includes various kinds of interactions.&amp;nbsp; But the issue is not just what the mix of types of contribution are, how stable, how variable among samples, and so on.&amp;nbsp; Even if Zuk et al. are materially correct, it doesn't erase the  problematic nature of trying to estimate, much less generally to do much  about, the joint effects of the many genes, in their tens or hundreds,  whose variation contributes to a trait of interest.&lt;br /&gt;&lt;br /&gt;&lt;b&gt;"Discovery efforts should continue vigorously"&lt;/b&gt;&lt;br /&gt;We ourselves are far from qualified to find technical fault with the new model, if there is any.&amp;nbsp; We doubt there is.&amp;nbsp; But the point is not that this new paper is flim-flam, even if it simplifies and makes many assumptions that could be viewed as perhaps-necessary legerdemain, given the situation's complexity.&amp;nbsp; Or, perhaps more clearly, red-herrings to distract attention from the real point, which is&amp;nbsp; whether changing the goalposts in this kind of way changes the game.&lt;br /&gt;&lt;br /&gt;One can ask--&lt;i&gt;should &lt;/i&gt;ask--whether regardless of interaction or additivity, it's worth trying to document them, or whether Francis Collins' insistence on luxury medicine (personalized prediction of weak effects with lifelong treatment mainly available to paying customers) is a realizable goal.&amp;nbsp; The same funds could, after all, be spent in other ways on indisputably stronger and simpler genetic problems, that could be far more directly and sooner relevant to the society that's paying the bill.&lt;br /&gt;&lt;br /&gt;Arguing either/or (additive or non-additive) and attempting to relate that to the desirability of keeping the Big Study funds flowing is a carnival barker activity.&amp;nbsp; The authors at one point subtly make the anti-Collinsian but obvious point that personalized gene-based prediction is generally going to be a bust.&amp;nbsp; But then they argue let's plow ahead to discover pathways. Let's have our goalposts everywhere at once!&amp;nbsp; There are other, better, logistically easier and probably less costly ways to find networks and if there aren't already, there ought to be research invested in figuring them out (e.g., in cell cultures).&amp;nbsp; Epidemiological studies are expensive and of low payoff in this kind of context.&lt;br /&gt;&lt;br /&gt;As the authors clearly say: discovery efforts should continue vigorously" despite their points, acknowledging in fact and cleverly hedging all bets, that many variants remain to be discovered by current approaches.&amp;nbsp; This is a fair-grounds where PT Barnums thrive.&amp;nbsp; It keeps their particular circus's seats filled.&amp;nbsp; But that doesn't make it the best science in the &lt;i&gt;public&lt;/i&gt; interest.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-1988217960879474921?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/1988217960879474921/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/changing-goal-posts-heritability-lost.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1988217960879474921'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1988217960879474921'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/changing-goal-posts-heritability-lost.html' title='Changing the goal posts: heritability lost and found'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-uY1Ceon29VI/TxNc-tOgXaI/AAAAAAAACO8/tTDesImzsHg/s72-c/File-Alice+05a-1116x1492.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-8621996377228936726</id><published>2012-01-13T05:34:00.000-05:00</published><updated>2012-01-13T05:34:00.271-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='risk'/><category scheme='http://www.blogger.com/atom/ns#' term='probability'/><category scheme='http://www.blogger.com/atom/ns#' term='de Finetti'/><title type='text'>Probability does not exist. Part I.  The very idea!</title><content type='html'>&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-yevFhaQTJMo/Tww8_oWo1YI/AAAAAAAACOs/FmWG9a8p7yE/s1600/Dice.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="150" src="http://2.bp.blogspot.com/-yevFhaQTJMo/Tww8_oWo1YI/AAAAAAAACOs/FmWG9a8p7yE/s200/Dice.jpg" width="200" /&gt;&lt;/a&gt;&lt;/div&gt;We have occasionally mused here on MT about what it means to talk about the risk of such-and-such -- 12% risk of heart attack, 30% risk of rain, 80% risk of a double dip recession. &amp;nbsp;For example, this could either mean everyone is at 12% risk (a fairly elusive concept), or that 12% of the group have 100% risk and the rest have 0%. &lt;br /&gt;&lt;br /&gt;We are lead to post on this now because of a recent BBC Radio 4 program, &lt;a href="http://www.bbc.co.uk/programmes/b006qshd"&gt;More or Les&lt;/a&gt;s, which is always about the meaning of statistics, but the Dec 30 program happened to mention the Italian statistician, Bruno de Finetti and his book, &lt;i&gt;&lt;a href="http://www.amazon.com/Theory-Probability-Introductory-Mathematical-Statistics/dp/0471588822/ref=sr_1_3?ie=UTF8&amp;amp;qid=1325969823&amp;amp;sr=8-3"&gt;Theory of Probability&lt;/a&gt;, &lt;/i&gt;which begins thus:&lt;br /&gt;&lt;div class="column"&gt;&lt;blockquote class="tr_bq"&gt;&lt;span style="font-family: Times;"&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; PROBABILITY DOES NOT EXIST&lt;/span&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;span style="font-family: Times;"&gt; The abandonment of superstitious beliefs about the existence of the Phlogiston, the Cosmic Ether, Absolute Space and Time, &lt;/span&gt;&lt;span style="font-family: MTMI;"&gt;. . . &lt;/span&gt;&lt;span style="font-family: Times;"&gt;or Fairies and Witches was an essential step along the road to scientific thinking. Probability, too, if regarded as something endowed with some kind of objective existence, is no less a mis-leading misconception, an illusory attempt to exteriorize or materialize our true&amp;nbsp;&lt;/span&gt;probabilistic beliefs.&amp;nbsp;&lt;/blockquote&gt;So, God is dead, but what does this mean, exactly? &amp;nbsp;A 2002 &lt;a href="http://faculty.fuqua.duke.edu/%7Ernau/definettiwasright.pdf"&gt;paper&lt;/a&gt;&amp;nbsp;by Robert Nau on de Finetti's thesis explains that de Finetti meant that probability is nothing but a subjective analysis of the likelihood that something will happen, that probability does not exist outside the mind. &amp;nbsp;That is, it's the rate at which a person is willing to bet on something happening. &amp;nbsp;This is as opposed to the classicist or the frequentist's view of the likelihood of aparticular outcome of an event. That view depends on the assumption that the same event could be identically repeated many times over, and then 'probability' of a particular outcome has to do with the fraction of the time that outcome results from the repeated trials.&amp;nbsp; This example from Nau's paper clarifies the differences in approach.&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span style="font-family: Times; font-size: 12pt;"&gt;For example, in the case of a normal-looking die that is about to be tossed for the first time, a classicist would note that there are six possible outcomes which by symmetry must have equal chances of occurring, while a frequentist would point to empirical evidence&amp;nbsp;&lt;/span&gt;&lt;span style="font-family: Times; font-size: 12pt;"&gt;showing that similar dice thrown in the past have landed on each side about equally often. A subjectivist would find such arguments to be suggestive but needlessly encumbered by references to superfluous events. What matters are her &lt;/span&gt;&lt;span style="font-family: Times; font-size: 12pt; font-style: italic;"&gt;beliefs &lt;/span&gt;&lt;span style="font-family: Times; font-size: 12pt;"&gt;about what will happen on the single toss in question, or more concretely how she should &lt;/span&gt;&lt;span style="font-family: Times; font-size: 12pt; font-style: italic;"&gt;bet, &lt;/span&gt;&lt;span style="font-family: Times; font-size: 12pt;"&gt;given her present information. If she feels that the symmetry argument applies to her beliefs, then that is sufficient reason to bet on each side at a rate of one-sixth. But a subjectivist can find other reasons for assigning betting rates in situations where symmetry arguments do not apply and repeated trials are not possible.&lt;/span&gt;&lt;/blockquote&gt;In other words, the idea is that probability is not part of the real world, &lt;i&gt;only&lt;/i&gt; of one's belief in the nature of that world.&lt;br /&gt;&lt;br /&gt;What does this have to do with the risk of having a heart attack? &amp;nbsp;Well, how much are you willing to bet on your chances? &amp;nbsp;That is, if your chances are 20%, and you feel that's high, you might be willing to do whatever you can to reduce your cholesterol, you might take up going to the gym more regularly, quit smoking, or become a vegan. &amp;nbsp;Someone else, though, might feel that 20% is not so high, and do nothing at all to alter their (what are currently considered to be) risk factors. But the physical basis of that belief is far less clear than the &lt;i&gt;idea&lt;/i&gt; of the belief.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;And, physicians advising us differ in how much they are willing to bet on the probability we'll get sick. Some are very diligent about cholesterol, some less so, some advise all men of a certain age to have a PSA test for prostate cancer, others none. &amp;nbsp;They are reading the same probabilities, but what they make of them differs. Indeed, the question of interpretation is secondary to the notion of probability itself.&lt;br /&gt;&lt;br /&gt;Yet, how do we account for the role that probabilities do play in the  real world, such as in the example from which much of probability was  developed, when events can be repeated: gambling.&amp;nbsp; And 'bet' is the appropriate operational concept.&amp;nbsp; The formal theory was largely developed in the literal context of gambling, but the same idea applies to health.&lt;br /&gt;&lt;br /&gt;In rolling dice, we have 6 outcomes and no reason to prefer any of them (see below!).&amp;nbsp; If we know about rolling, we might, in advance, decide that each possible outcome would be as likely to result.&amp;nbsp; We don't&amp;nbsp; know which, so we might say that in a large number of rolls, each face would come up the same number of times.&lt;br /&gt;&lt;br /&gt;In fact, however gambling notions of probability first arose (scholars have some ideas, but we don't), by the time formal theories were being developed, there was extensive and systematic experience with &lt;i&gt;past &lt;/i&gt;sets of rolls that actually did occur (apparently not obviously so in Roman times, where gambling with bones  was thought to be related to things like how the gods viewed the  gambler, etc.).&amp;nbsp; We don't personally know how extensive such data, experimental or otherwise, were but the notions of equal occurrences not only seemed intuitive at the time but backed up by experience.&amp;nbsp; '6' came up about 1/6th of the time in dice games, leading naturally to a theory that all sides had equal chances to arise -- fractions of the times it will arise.&lt;br /&gt;&lt;br /&gt;Heart attack risks based on, say, cholesterol levels, are based on past experience, too.&amp;nbsp; But unlike dice, people are more than simple structures.&amp;nbsp; We have more than cholesterol levels.&amp;nbsp; So the fraction of people with cholesterol over some level, who had heart attacks in our studies, is used to estimate the fraction of people with such level will have a coronary &lt;i&gt;in the future&lt;/i&gt;.&amp;nbsp; Yet we know very well that each person's 'ancillary' risk factors in the data on which the probability was based were different, and worse, that we simply cannot know about those risk factors in the future.&amp;nbsp; So what does the genetic-risk-perveryer's probability actually mean?&lt;br /&gt;&lt;br /&gt;We also talk in probabilistic terms when we say such things as that God probably exists (or doesn't).&amp;nbsp; This clarifies the &lt;i&gt;un&lt;/i&gt;clarity of such wording.&amp;nbsp; God either does or doesn't exist, clearly without any actual 'probability', so this is really just a statement, using a serious-sounding word, of strength of belief.&amp;nbsp; If you examine it closely, the same really applies to similar statements about whether we'll have a heart attack or not, or whether 5 &amp;amp; 6 will come up on the next roll of a pair of dice.&amp;nbsp; Even those sound more rigorous, or suggest experiments or relevance to actual data, even they are based on the assumption that multiple replicates of unique events can take place, &lt;i&gt;and &lt;/i&gt;they are based on some idea, or 'model', of the process involved such as how we measure cholesterol, how we sample people and measure their cholesterol and diets and obesity and so on), and even how dice are rolled (see next installment!).&lt;br /&gt;&lt;br /&gt;Some statisticians and books and lectures simply assume that we know what probability is and don't attempt to define it, or to do so in practical or frequentist terms.&amp;nbsp; Others try to wriggle out of this situation by saying that the frequentist terms can be disregarded and that there are other systematic ways to extract from the available data alone, some idea of what our best idea of the situation is.&amp;nbsp; These are called 'likelihood' and 'Bayesian' approaches (there may be others we're not aware of), but if they stay somewhat closer to actual data, they essentially are ways to strengthen belief, and belief is in ourselves rather than a physical property of the object of belief.&amp;nbsp; That is the subjectivist assertion.&lt;br /&gt;&lt;br /&gt;Next time, we'll show how the meaning of&amp;nbsp; 'probability' or the interpretation of repeated events in probability terms--even in seemingly simple cases like coin-flipping or dice-rolling--are far from clear.&lt;br /&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-8621996377228936726?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/8621996377228936726/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-i-very.html#comment-form' title='24 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8621996377228936726'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8621996377228936726'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/probability-does-not-exist-part-i-very.html' title='Probability does not exist. Part I.  The very idea!'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-yevFhaQTJMo/Tww8_oWo1YI/AAAAAAAACOs/FmWG9a8p7yE/s72-c/Dice.jpg' height='72' width='72'/><thr:total>24</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-554967843510869127</id><published>2012-01-12T05:01:00.000-05:00</published><updated>2012-01-12T08:59:47.135-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='TOFT'/><category scheme='http://www.blogger.com/atom/ns#' term='SMT'/><category scheme='http://www.blogger.com/atom/ns#' term='cancer'/><title type='text'>Do we still not know what causes cancer?  Part III</title><content type='html'>This series of posts is about cancer but also about the nature of life itself.&lt;br /&gt;&lt;br /&gt;Do we still not know what causes cancer?&amp;nbsp; We've discussed the origin of the current theory of cancer, the SMT or somatic mutation theory.&amp;nbsp; As we outlined in &lt;a href="http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer.html"&gt;Part I,&lt;/a&gt; this 50 year old view, that cancer is a disease of&amp;nbsp;&lt;i&gt;diseased &lt;/i&gt;cells that have been screwed up by genetic mutation, has focused almost all cancer research in one way or another.&amp;nbsp; It is relevant as well to a proper understanding of life itself, as we suggested in Part II.&amp;nbsp; Is the lack of progress in cause-directed (that is, gene-based) therapy, a result of a badly misdirected effort, rather than just the heavy challenge of targeting genetically altered cells?&lt;br /&gt;&lt;br /&gt;The competing 'tissue organization field theory' (TOFT) is that cancer is a tissue rather than cellular disease, and goes roughly like this, as outlined by Soto and Sonnenschein (hereafter, SS)&amp;nbsp; in the &lt;a href="http://onlinelibrary.wiley.com/doi/10.1002/bies.v33.5/issuetoc"&gt;May 2011&lt;i&gt; BioEssays&lt;/i&gt;&lt;/a&gt; point-counterpoint that triggered this series of posts:&lt;br /&gt;&lt;br /&gt;SS point to several aspects of cancer that do not reflect simple genetic causation, or simple one-cell-gone-bad-on-its-own&amp;nbsp; model of causation; the latter is what they, very inaptly in our view, imply is the heart of the SMT model.&amp;nbsp; Experiments show that a single transplanted cell cannot generate the multiple cell type architecture of the organ from which it was taken.&amp;nbsp; Sometimes cancers regress, or a transplanted cancer cell can integrate into a normal tissue architecture in the recipient organ without proliferating as a cancer.&amp;nbsp; That means that the cell is not, in these experiments, inherently abnormal as might be expected on a genetic model, assuming no experimental artifact.&amp;nbsp; Some tumors regress upon&amp;nbsp; hormone treatment, again showing that their abnormal behavior may be a matter of signaling and that it can be reversed or slowed by changing the signaling environment: the cell is not inherently mischievous.&amp;nbsp; Some normal cells can become cancerous if transplanted to some other tissue context, showing that mutations are not needed.&amp;nbsp; Environment may not be everything, but it's not nothing, either.&lt;br /&gt;&lt;br /&gt;Further, SS point out that interactions among the different types of cell in a tissue cannot be reduced to individual cellular events.&amp;nbsp; That seems wholly correct, and shows the clearly relevant 3-dimensional architecture of tissues.&amp;nbsp; Most cancers arise in tissues that include both supportive (stromal) cells and actively dividing organ-specific functional (parenchymal, often epithelial) cells, and that these must interact in normal as well as abnormal tissues.&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-qPRIbfnwo6M/TvoT47FrxII/AAAAAAAAAHk/UOgye_iMg-o/s1600/Screen+Shot+2011-12-27+at+1.51.18+PM.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="302" src="http://2.bp.blogspot.com/-qPRIbfnwo6M/TvoT47FrxII/AAAAAAAAAHk/UOgye_iMg-o/s320/Screen+Shot+2011-12-27+at+1.51.18+PM.png" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;&lt;br /&gt;The figure is from the SS paper showing their idea of how context affects tumorigenesis.&amp;nbsp; Of course, they want this to be a tissue-architecture phenomenon in which the 'carcinogenic event' is not a genetic mutation.&amp;nbsp; They may well be right that many triggering events are not themselves mutations (but the SMT asserts that induced by the event to proliferate, the cells become vulnerable to mutation).&amp;nbsp; In any case, one could offer the same figure for events that are mutational, because of course once a cell does not respond to its environment properly it could be induced to grow in undisciplined ways for that tissue, as cancer cells do.&lt;br /&gt;&lt;br /&gt;SS seem to criticize the genetic theory of cancer because tumors of the same organ from different patients seem to involve different sets of mutations, as if variation among cases (and imperfection of mutation detection methods) means that the SMT is an erroneous view.&amp;nbsp; Of course there are limits to what kinds of mutations can be detected in complex cancerous tissue (that also contains normal vessels, nerves, and so on), but in a &lt;i&gt;polygenic&lt;/i&gt; view of cancer, as a complex trait involving many genes and signaling pathways, like other complex traits,&amp;nbsp; this variation and multiple gene involvement is not a reflection of a wiggling, erroneous theory, but is just what one would expect.&amp;nbsp; No geneticist we know thinks otherwise, even if they may want simpler answers (as many GWASers do).&lt;br /&gt;&lt;br /&gt;SS focus their discussion only on 'sporadic' cancers,  that is, ones without a family history of the same tumor type.&amp;nbsp; That is a completely false, indeed naive, dichotomy.&amp;nbsp; Most if not every  cancer, being a polygenic trait, will involve some inherited risk  components, even if GWAS or whole genome sequencing of tumor vs  host-normal tissue can't detect weak effects.&amp;nbsp; SS are quite wrong that  most 'inherited' cancers are early onset or pediatric--they are not  including the multigenic effects, so theirs is a quite restricted view.&lt;br /&gt;&lt;br /&gt;According  to SMT, cancer is a disease of sick cells in a normal environment.&amp;nbsp; But  in TOFT, it is a disease of normal cells in a sick environment.&amp;nbsp; The  SMT is a special case of genetic evolution because modified genomes can  be inherited but, since cancer is a disorder of tissue architecture,  abnormal tissue architecture cannot--a fertilized egg has no tissue!&lt;br /&gt;&lt;br /&gt;A recent and very informative &lt;a href="http://www.bbc.co.uk/programmes/b018grhm"&gt;installment&lt;/a&gt; of our favorite BBC Radio4 program &lt;i&gt;&lt;a href="http://www.bbc.co.uk/radio4/features/in-our-time/"&gt;In Our Time&lt;/a&gt;&lt;/i&gt; discusses macromolecules, and we posted on that separately, starting &lt;a href="http://ecodevoevo.blogspot.com/2012/01/polymers-and-not-so-secret-secret-of.html"&gt;here&lt;/a&gt;.&amp;nbsp; But this installment just casually drops an observation about biomedical applications of macromolecules that is relevant here.&amp;nbsp; Webs of supporting tissue can now be constructed of synthetic macromolecules, and embedded with stem cells, then placed in context to repair skin, trachea (windpipe) or other types of tissue, where the cells flesh out the matrix which develops into normal tissue.&amp;nbsp; The casual comment is that each application requires a different artificial matrix, because stem cells respond differently to different substrates.&amp;nbsp; Clearly context matters!&lt;br /&gt;&lt;br /&gt;We scientists are vain and we all want to be part of a major 'paradigm shift' in our respective fields--we want to be important, to live in important times, and to be the architect of a grand transformative event.&amp;nbsp; So it is common that we want to suggest (and, of course, name) new sweeping theories.&amp;nbsp; That may sometimes be correct, as it was for Newton, Darwin, Einstein and others of their fortunate and insightful ilk, but that's very rare, and it is usually uncalled for.&amp;nbsp; TOFT vs SMT oversimplifies what seem to be overlapping phenomena related to cancer--and, indeed life and its evolution itself.&amp;nbsp; But there is no conceptual revolution involved.&amp;nbsp; Cells induced by whatever means to misperceive or or respond wrongly to their signaling environmental context can go off on their own, until correct in some way, or in some instances can get out of any such control.&amp;nbsp; There's no reason to be surprised at that.&lt;br /&gt;&lt;br /&gt;SS, hinting perhaps that they are paradigm-shifters themselves, conclude by citing some philosophers of science and using that to criticize the revisions that SMT advocates regularly make in their theory as the result of experiments that, SS argue, support TOFT instead.&amp;nbsp; There is an exchange of barbs in the &lt;a href="http://onlinelibrary.wiley.com/doi/10.1002/bies.v33.9/issuetoc"&gt;September issue of &lt;i&gt;BioEssays&lt;/i&gt;&lt;/a&gt;, but it adds nothing of substance to the discussion; there, SS again sneer at changes in the SMT theory as 'changing the goal posts', but indeed that is exactly what any valid theory of life (or any area of science) must do as more is learned.&amp;nbsp; It is only a valid criticism if the fundamental aspects of the theory are abandoned, but this is not at all the case.&amp;nbsp; Indeed, as the exchanges show, the SMT is only strengthened--especially if one takes context into account, as it must.&lt;br /&gt;&lt;br /&gt;In our view, nobody can deny the importance of context or even that cells that are mis-informed about or that mis-interpret their environment can launch out-of-control growth.&amp;nbsp; But SS seem again to suggest that geneticists are holding essentially to single-gene concepts of causation, which as we noted above we think no sane geneticist does--even if some mutations may make individually strong contributions to risk. After all, BRCA mutations do that, yet nobody thinks the tumor waits 40 or more years to show up except because other events must also occur (indeed, BRCA genes are involved in mutation repair!).&lt;br /&gt;&lt;br /&gt;But such philosophizing is irrelevant if not self-serving baloney!&amp;nbsp; Every science is always imperfect, and always under revision as new facts become known.&amp;nbsp; Whether the revisions in SMT are cogent is a separate question, but revision itself is not a fault.&amp;nbsp; Likewise, SS basically ignore the huge wealth of evidence of clonality and the many clearly known mutations relevant to cancers (in a sense, they don't even &lt;i&gt;try &lt;/i&gt;to revise the TOFT).&amp;nbsp; None of this means we have 'the' answer, because there may be no single answer.&amp;nbsp; These are not dichotomous, incompatible views of abnormal cell behavior.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;In the end the SMT theory, that cancer can and usually does involve genomic mutations, is completely defensible, as Vaux very powerfully shows in his part of the &lt;i&gt;BioEssays&lt;/i&gt; exchange.&amp;nbsp; This doesn't mean cancer is just a disorder of isolated cells!&amp;nbsp; Naturally, context must matter.&amp;nbsp; And, instances of cancer cells becoming normal, or not leading to cancer when transplanted into a normal context, shows that SMT can be oversimplistic.&amp;nbsp; But a polygenic view of cancer at the cell level is totally consistent with both.&amp;nbsp; Mutations are involved, but cancer is a disease, at least in part, of mis-cooperation--aberrant signaling or response to context.&lt;br /&gt;&lt;br /&gt;We can't resist our own vanity in pointing out that in and around 1990, I had suggested in several papers and a book a somatic-polygenic etiology for cancer, in terms that for the specifics known in its time were essentially modern conceptually, and that were consistent with a contextual yet genetic idea of the nature of cancer.&amp;nbsp; The idea was compatible with what we know (and knew) of epidemiology,&amp;nbsp; genomic evolution and causation, and that cancer is a disorder of misbehaving cells, involving gene networks.&amp;nbsp; A similar view is the bottom line message of MT, the book.&amp;nbsp; A&amp;nbsp; mix of somatic and inherited genomic architecture involving multiple contributing genes, in a tissue context stimulated by non-genetic environmental factors such as mutagens and stimulants of cell division, provides a consistent if not simplistic view of cancer, because it puts cancer into the context of normal biology and its geological as well as somatic evolution.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;False dichotomies here, as so often, reflect yearning for simple explanations for complex phenomena.&amp;nbsp; In fact, what we clearly know about the nature of genomic action, and the essential role of cooperation in the making and maintenance of multicellular organisms, shows that we need no all-or-none 'theories'.&amp;nbsp; We just need to view cancer as a phenomenon in the kind of biology we already know very well.&amp;nbsp; That there will be variation in the trait and its cause is exactly what we expect.&amp;nbsp; So is the fact that causation can be difficult to attribute to individual factors.&amp;nbsp; That we cannot simplify polygenic phenomena is an apparent reality.&amp;nbsp; It's not a matter of one wrong or right theory.&amp;nbsp; It's a reflection of how life works!&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-554967843510869127?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/554967843510869127/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_5801.html#comment-form' title='8 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/554967843510869127'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/554967843510869127'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_5801.html' title='Do we still not know what causes cancer?  Part III'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-qPRIbfnwo6M/TvoT47FrxII/AAAAAAAAAHk/UOgye_iMg-o/s72-c/Screen+Shot+2011-12-27+at+1.51.18+PM.png' height='72' width='72'/><thr:total>8</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-1945367396542572543</id><published>2012-01-11T05:21:00.000-05:00</published><updated>2012-01-11T09:15:56.990-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='TOFT'/><category scheme='http://www.blogger.com/atom/ns#' term='SMT'/><category scheme='http://www.blogger.com/atom/ns#' term='tissue organization field theory'/><category scheme='http://www.blogger.com/atom/ns#' term='somatic mutation theory'/><category scheme='http://www.blogger.com/atom/ns#' term='cancer'/><title type='text'>Do we still not know what causes cancer?  Part II</title><content type='html'>&lt;a href="http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer.html"&gt;Part I &lt;/a&gt;in this series described the SMT, or somatic mutation theory of cancer.&amp;nbsp; The original theory was developed from some data on both the epidemiology and the known cases of inheritance of cancer susceptibility.&amp;nbsp; It lead to a focus on the idea that, at the cell level, cancer was a misbehavior disorder due to mutations--changes in DNA--in genes whose normal function was critical for the cell type in question--be it lung cells, intestinal cells, or other tissues.&amp;nbsp; The cell can't behave properly if its relevant genes have been changed.&amp;nbsp; The idea is then that a given case of cancer is due to the spread of a clone of cells, descended in the person's body from a single initial 'transformed'--misbehaving--cell, and cells in that clone then accumulate a diversity of subsequent mutations.&lt;br /&gt;&lt;br /&gt;Tests of clonality and searches for mutations have been done, and these have been successful.&amp;nbsp; Similarly, genomewide tests have shown that cancer cells, relative to host normal cells, do reflect many mutational differences.&amp;nbsp; At least some of these are repeatedly found, and are in genes related to cell division and other relevant aspects of behavior.&amp;nbsp; Some of these changes can be inherited, leading to elevated risk, as we described briefly in Part I.&amp;nbsp; The picture was complex--essentially, polygenic, with different tumors manifesting different mutations.&amp;nbsp; Still, patterns of mutational change have been shown to be relevant to response to therapy and prognosis.&amp;nbsp; It all seemed consistent with the SMT.&lt;br /&gt;&lt;br /&gt;However, there were some weak points in the data.&amp;nbsp; Normal cells also show mutations, and cataloging the differences from tumor cells is difficult.&amp;nbsp; After all, even under the SMT, normal cells would be expected to show mutations in the same genes found changed in tumors, because that's how the combinations of 'bad' changes accumulate.&lt;br /&gt;&lt;br /&gt;Further, a 'theory' of the essential qualities of life, that goes beyond our contemporary obsession with Darwinian selection and genetic determinism based on competition, such as we try to discuss in MT (here, and in our book of the same name), stresses the role of complex multi-component &lt;i&gt;cooperation &lt;/i&gt;in the nature of life among organisms, species, and cells.&amp;nbsp; Signaling interactions are a fundamental property of that cooperative aspect of life.&amp;nbsp; A cell's behavior is instructed by its current constituents (including the genes it's using at the time) and the conditions it detects in its environment.&amp;nbsp; What it detects alters the genes it will express or repress.&amp;nbsp; A stomach cell expresses appropriate genes for stomach-related behavior, but not genes involved in, say, liver, brain, or blood.&amp;nbsp; When the environment changes, the cell changes its gene expression and its behavior (thus, when a stomach stem cell detects the absence of adjacent differentiated stomach cells, it divides to replace the lost cells.&lt;br /&gt;&lt;br /&gt;What we know about such complex phenomena is that they typically are &lt;i&gt;polygenic&lt;/i&gt;, that is, are affected by many genes, and their variation can be due to many different combinations of variation in those genes.&amp;nbsp; This is what we write a lot about, for example, in the context of GWAS findings.&amp;nbsp; In our view, to this extent, cancer like other complex traits, is a polygenic phenotype involving cell-to-cell signaling as a determinant of the complex structure of organs like lungs, skin, brains, and ovaries.&lt;br /&gt;&lt;br /&gt;Thus, a key feature of life is properly timed preparation, detection, and responsiveness of cells.&amp;nbsp; Once it becomes committed to the environment it has been prepared to detect, or to whose changes it detects, it is channeled in particular directions....and its set of expressed response detectors (signal receptors, for example) limit what it can do in the future.&amp;nbsp; In a polygenic view of tissue behavior, there would be many different ways to go awry.&lt;br /&gt;&lt;br /&gt;Viruses and other cellular components, normal and from the outside, can also enter the genome or pop&amp;nbsp; copies of themselves elsewhere in the genome.&amp;nbsp; This can lead to abnormal effects on the regular genes in the vicinity of the genome where such a copy has, by chance, landed.&amp;nbsp; For example, a gene may be induced to be expressed abnormally as the result of such events.&amp;nbsp; This is not a mutation in the expressed gene itself, but in its anomalous usage.&amp;nbsp; But once the transposed bit of DNA is there, the cell and its descendants are doomed to obey its effects!&amp;nbsp; It is, in a sense, a kind of somatic mutation, but would never be detected in sequencing the affected gene itself.&lt;br /&gt;&lt;br /&gt;The &lt;a href="http://onlinelibrary.wiley.com/doi/10.1002/bies.v33.5/issuetoc"&gt;May 2011 &lt;i&gt;BioEssays&lt;/i&gt;&lt;/a&gt; point-counterpoint includes one part, by Vaux, defending the SMT, but opposed by Soto and Sonnenschein who argue for a tissue organization field theory (TOFT).&amp;nbsp; One need not accept all-or-nothing combative 'theories' to ask whether we have somehow misinterpreted the SMT, leading to a research focus that will have only limited success, if based on the expectation of mutant genes as the cause of cancer.&amp;nbsp; That can be important, of course, in the research approach to effective therapies. But it could also be important in what we understand about genetics....and even about evolution and life itself.&amp;nbsp; That's because we might have been too deterministic in assuming genomes to be self-contained 'programs for life'.&lt;br /&gt;&lt;br /&gt;This can be of fundamental importance for understanding life, far beyond its relevance to cancer.&amp;nbsp; That's because cooperation among genes and other cellular components, rather than gene structure itself, may provide the critical explanation of cellular behavior--even if genetic variation indubitably would be one way to affect that cooperation.&amp;nbsp; In part III of this series, we'll discuss the basic ideas underlying TOFT.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-1945367396542572543?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/1945367396542572543/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_11.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1945367396542572543'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1945367396542572543'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer_11.html' title='Do we still not know what causes cancer?  Part II'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-1673952215654646898</id><published>2012-01-10T05:32:00.000-05:00</published><updated>2012-01-10T05:32:00.367-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='SMT'/><category scheme='http://www.blogger.com/atom/ns#' term='somatic mutation theory'/><category scheme='http://www.blogger.com/atom/ns#' term='cancer'/><title type='text'>Do we still not know what causes cancer?  Part I</title><content type='html'>Many theories have been proposed for the causes of cancer.&amp;nbsp; We were involved in some of this work, long ago, before molecular approaches were possible.&amp;nbsp; We were present when various immunological and other theories were being displaced by a genetic theory, and that theory has been developed over the years.&amp;nbsp; Cancer is an evolutionary as well as genetic phenomenon, but it's the evolution of genetic variation among cells within the body.&lt;br /&gt;&lt;br /&gt;A few observations, too much to go into here but involving a fairly rare childhood eye cancer called retinoblastoma, led to the idea that one could inherit susceptibility mutations (variation in particular genes), but that that required waiting for other mutations to occur &lt;i&gt;somatically&lt;/i&gt;, that is, in body cells as they divide throughout life.&amp;nbsp; Three of the key bits of evidence were, first, that frankly inherited susceptibility seemed rather rare (and it still does, for most types of cancer), even if inherited variation contributes to risk.&amp;nbsp; Second, it was shown by some clever early experiments that cancers are clones of cells within the affected person's body: the tumor began as a single 'transformed' cell.&amp;nbsp; Third, the risk of cancer rises with age in a way that seemed consistent with waiting time distributions; that is, a person had to 'wait' until some single cell was transformed, to become the progenitor of the tumor as it grew and sometimes spread around the body (metastasized).&lt;br /&gt;&lt;br /&gt;Together, these facts suggested that cancer was a multihit, mutational disease. &amp;nbsp;It was a genetic disease because the progenitor cell was transformed by mutations.&amp;nbsp; It was clonal in that this single cell led to the entire descendant set of cells that comprised the tumor.&amp;nbsp; And it was multihit in the sense that many different mutations were required to transform a cell.&amp;nbsp; This was the somatic mutation theory (SMT) of cancer, which is what we ourselves worked on when we were in Texas long ago.&amp;nbsp; The idea is that cancer is a disorder of the cell itself, a damaged cell that did not behave properly in its context.&lt;br /&gt;&lt;br /&gt;The age pattern of cancer--how fast risk increased with age--could be associated with the type of tissue.&amp;nbsp; Carcinomas grow in dividing tissue.&amp;nbsp; In most organs, partly differentiated stem cells divide and become terminally differentiated for their type of tissue (stomach, intestine, etc.).&amp;nbsp; When the differentiated cells died or were sloughed of, the stem cell would divide and produce more terminally differentiated cells.&amp;nbsp; The tissue maintained its integrity because the cells had the right genes expressed, receptors on their surface, and so on, to behave properly for their type of tissue.&amp;nbsp; Stem cells were normally quiescent until stimulated to divide.&amp;nbsp; Somatic mutation released that inhibition and disrupted the orderly responsiveness, leading to the relatively undisciplined proliferation that is cancer.&lt;br /&gt;&lt;br /&gt;The more stem cells at risk in a given tissue type, and the more their natural pattern involved dividing and differentiating, the faster risk would accumulate.&amp;nbsp; If cells stopped dividing in a person's natural life-history, tumors became rarer and rarer as the person got older.&amp;nbsp; The pattern was consistent, and the age-pattern of onset suggested that many mutational 'hits'&amp;nbsp; were involved.&lt;br /&gt;&lt;br /&gt;Work using techniques that became available mainly in the 1980s was consistent.&amp;nbsp; Evidence of mutation in cancer cells compared to normal cells from the same individual implicated multiple different genes with (as in other complex traits), different sets of mutations in different tumors of the same type (lung, intestinal, etc.).&amp;nbsp; At the same time, some of these mutations could be inherited, if the person had inherited a good copy of the gene along with a defective one.&amp;nbsp; Then, one might have to wait for the bad-luck mutation of the other copy of that gene, along with some other genes.&amp;nbsp; That's why even strong risk-affecting mutations don't cause cancer right away; instead, you have to wait less time for some other complement of mutations to arise.&lt;br /&gt;&lt;br /&gt;It was clear that tumors were clones by and large, but as they grew and spread, new mutations, often involving unstable, multiple chromosomal changes, would arise so that the tumor itself then was comprised of a tree of varying descendant cells.&amp;nbsp; When the right (for the cell, though for the victim, the wrong) set of mutations arose, some cells gained the ability to spread more rapidly, to invade other types of tissue, and so on.&amp;nbsp; The more potent cells could out-compete the more sluggish ones, in a kind of selection.&amp;nbsp; This became a kind of natural selection when drug therapy is applied, as some cells could survive the drug, leading to resistant tumors.&amp;nbsp; The population of tumor cells were mutant but they were still the host's own cells, which explained why the immune system, structured to detect invading foreign cells, was not good at finding and removing them.&amp;nbsp; Modern genetic analysis of tumor cells and normal cells has generally found evidence consistent with these ideas.&lt;br /&gt;&lt;br /&gt;In this view, cancer is always a genetic disease and perhaps thus always amenable (in principle) to a genetic therapeutic approach:&amp;nbsp; find the mutant gene and target cells expressing it in ways that are specific, so as to leave the same person's normal cells unaffected.&lt;br /&gt;&lt;br /&gt;This was, then, an evolutionary theory of cancer involving genetic changes in somatic cells, complemented perhaps with some inherited mutations.&amp;nbsp; It had most of the elements of Darwinian organismal evolution, including its basis in genes.&amp;nbsp; It fit the epidemiology, including the role of environmental factors--largely being those that induced mutations or stimulated cell division.&amp;nbsp;&amp;nbsp;&amp;nbsp; It is a theory we worked on, wrote about, and believed seemed consistent with the evidence (including, yes, GWAS studies of cancer, and various cancer genome projects!).&amp;nbsp; We even suggested somatic polygenic models of evolution among body cells as consistent with the age-onset patterns.&lt;br /&gt;&lt;br /&gt;But this theory has been questioned on a number of grounds, and there are, as usual, alternative explanations.&amp;nbsp; These have been aired in a recent point-counterpoint in the &lt;a href="http://onlinelibrary.wiley.com/doi/10.1002/bies.v33.5/issuetoc"&gt;May 2011 &lt;i&gt;BioEssays&lt;/i&gt;&lt;/a&gt; in which the protagonists discuss serious questions about the somatic mutation theory of cancer.&amp;nbsp; The facts discussed above may apply, but they may not account for all cases of cancer....or perhaps the data have been interpreted in the context of an assumed theory and hence seemed to be consistent with that theory.....a bias we often write about here on MT.&amp;nbsp; Perhaps there are other kinds of causation.&lt;br /&gt;&lt;br /&gt;We'll discuss those, as raised in the article, in our next post in this short series.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-1673952215654646898?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/1673952215654646898/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1673952215654646898'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1673952215654646898'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/do-we-still-not-know-what-causes-cancer.html' title='Do we still not know what causes cancer?  Part I'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-3073107896936222866</id><published>2012-01-09T05:45:00.000-05:00</published><updated>2012-01-09T05:45:00.650-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='polymers'/><category scheme='http://www.blogger.com/atom/ns#' term='DNA'/><category scheme='http://www.blogger.com/atom/ns#' term='In Our Time'/><category scheme='http://www.blogger.com/atom/ns#' term='cooperation'/><title type='text'>Polymers: the not-so-secret Secret of Life.  Part II.  How it works</title><content type='html'>So, prompted by the recent BBC Radio 4 program, &lt;a href="http://www.bbc.co.uk/radio4/features/in-our-time/"&gt;&lt;i&gt;In Our Time&lt;/i&gt;&lt;/a&gt;, we &lt;a href="http://ecodevoevo.blogspot.com/2012/01/polymers-and-not-so-secret-secret-of.html"&gt;blogged last week&lt;/a&gt; about polymers,  long molecules made of strings of subunits.&amp;nbsp; Many naturally occurring polymers, and other physical structures like crystals, are built of large numbers of copies of the &lt;i&gt;same &lt;/i&gt;subunit--the same type of atom, for example.&amp;nbsp; Even many of the substances produced by organisms, such as starches, are basically like that.&lt;br /&gt;&lt;br /&gt;But the polymers of life, DNA, RNA, and proteins are different in a fundamentally important way.&amp;nbsp; They are constructed of chains of &lt;i&gt;different&lt;/i&gt; subunits.&lt;br /&gt;&lt;br /&gt;Life depends on the nature of heterogeneous polymers--made of arrangements of different chemical 'beads' in strings.&amp;nbsp; Life is a phenomenon of cooperation within the elements of and between, polymers.&amp;nbsp; One is DNA, with four types of bead, and another is proteins with 20 different types.&amp;nbsp; With just that knowledge alone, you couldn't tell whether the strings were from bacteria, fungi, plants, or animals.&amp;nbsp; The functional information in the string is based on the arrangement of the elements.&lt;br /&gt;&lt;br /&gt;Conceptually, think of these as strings of pop-beads, as in this figure, that we just grabbed from the web:&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://3.bp.blogspot.com/-y8UN49u3Y7w/Tv78-50TvYI/AAAAAAAAAH8/Pk1DDI6tksA/s1600/popbeads.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" src="http://3.bp.blogspot.com/-y8UN49u3Y7w/Tv78-50TvYI/AAAAAAAAAH8/Pk1DDI6tksA/s1600/popbeads.jpg" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;The four colors correspond to the 4 nucleotide types in DNA.&amp;nbsp; These 'DNA-beads' can be strung together in any order, and for basically any length.&amp;nbsp; Now imagine a DNA molecule that is a pop-bead string that's 300,000,000 beads long, stretching for about 25 miles.&amp;nbsp; Now there will be various short strings (say, yellow-yellow-green, or blue-blue-blue) that are seen again and again, and correspond to some function.&amp;nbsp; That may be that they code for some particular amino acid (a 'bead' in a protein string of amino-acid pop-beads).&amp;nbsp; Proteins are similar but use 20 different bead colors, each with its own shape.&amp;nbsp; This is how DNA codes for the amino acid strings in proteins, and you can easily imagine that the order of individual beads, and of these small sequences of beads, carries the information in the DNA.&amp;nbsp; And thousands of different proteins, with &lt;i&gt;their&lt;/i&gt; respective shapes are what carry out most of the jobs of life.&amp;nbsp; Not to be insulting, but the difference between you and a fungus is the set of these molecular shapes that you and it produce, and the sequence of the DNA that codes for them.&lt;br /&gt;&lt;br /&gt;But there's more.&amp;nbsp; The beads of all types have the same knobs and sockets that allow them to chain together, but they are also of different shapes.&amp;nbsp; That's important.&amp;nbsp; So, for example, you can see that a green bead might fit into the depression in a blue bead.&amp;nbsp; So a string floating freely in a cell could fold up on itself, with blue-green 'bonds'.&amp;nbsp; The location of the blues and greens along the chain would determine where this folding occurred, and that in turn would give the self-folded chain a particular shape, and that shape could perhaps interact with the folded shapes of other, different strings.&lt;br /&gt;&lt;br /&gt;Or, folded up molecules might patrol along a DNA-bead string, and wherever they found, say, blue-yellow-yellow-blue-red, they could stick to the shape of that bead sequence.&amp;nbsp; That could in turn attract other such molecules to the location.&amp;nbsp; This kind of bonding to DNA is what controls many of its functions: which nearby strings are made into RNA and then used to code for protein--that is, which of its genes a given type of cell uses, or into RNA that folds up upon itself as described above, giving it some function.&lt;br /&gt;&lt;br /&gt;The point here is that with these shape-recognition features leading proteins and DNA to take shapes, and stick to parts of themselves or of other molecules based on these shapes, is the essence of how life works.&amp;nbsp; And why we say that life is a &lt;i&gt;polymer&lt;/i&gt; phenomenon.&amp;nbsp; And it is all of these recognition-based interactions that give a cell or an organism its specificity.&amp;nbsp; And to do that, its countless components must be present in the right combinations at the right times.&amp;nbsp; That is, they must &lt;i&gt;cooperate&lt;/i&gt;.&lt;br /&gt;&lt;br /&gt;Messages are passed between cells that cause cells to change what they do, including which of their genes they use.&amp;nbsp; The message and the message-detector (signal and signal receptor molecules) are of the pop-bead type.&amp;nbsp; When the two join up, that triggers hundreds of other such interactions in the cell.&amp;nbsp; For the right messages to be passed, some cell somewhere must make and release the signal, and other cells must make the receptors and response molecules.&amp;nbsp; All of this is an exotic dance of similar cooperation.&lt;br /&gt;&lt;br /&gt;To understand life this is what one must understand.&amp;nbsp; Variation in polymer arrangement leads to changes in function, and that can affect probabilities or rates of proliferation, and this of course is what evolution is all about.&amp;nbsp; A genetic change (mutation) is a change of the order of the DNA 'pop-beads', and if that leads to something that works, or works better under current circumstances, the change will be passed on to the next generation.&amp;nbsp; If some particular bead-order systematically confers an advantage, it may be transmitted more frequently than others in the population; that's what we call Darwinian natural selection.&amp;nbsp; But whether because of competitive advantage or just luck, different lineages of life accumulate different bead-orders, diverging more and more over time.&lt;br /&gt;&lt;br /&gt;In this sense, that things have to be present together at the  right time and place, in the right locations and combinations, makes  life a &lt;i&gt;logical &lt;/i&gt;phenomenon.&amp;nbsp; It's about presence and absence,  combinations, arrangements, in space and time.&amp;nbsp; Since the same elements  like signaling factors and their cell-surface receptors--the same substrings of pop-beads, can be used in  different combinations to bring about different organs or structures,  shows this rather clearly.&amp;nbsp; There's nothing physical about a signal  factor or its receptor that resembles the physical structures of limbs  or teeth, but the presence of the same factors, in different timing or  combinations, is what makes these various structures.&amp;nbsp; And it is the  differential use of these factors, triggered by signal-receptor  combinations and regulatory protein-DNA binding, that makes different  cell types (and, by extension, different species) what they are. Again,  this shows that it is the logic rather than the specific physical traits  that matter.&amp;nbsp; And this logic, combinations and arrangements, that is  the essence of cooperation among the interacting elements that make an  organism or a species or an ecosystem.&amp;nbsp; And all of this depends on, and is produced by, polymers made of non-identical 'beads'.&lt;br /&gt;&lt;br /&gt;The discovery that evolution is a process of divergence from common ancestor, with the divergence increasing over time because of differential rates or patterns of proliferation of genomic variation--variation in the organisms among information-bearing polymers--has been perhaps more transformative than any other single realization in the history of science.&amp;nbsp;&amp;nbsp; There are no 'paradigm shifts' involved, but there is a need for a rebalance of the central ideas or theory of life, to recognize that, yes, competition certainly does occur, but the essence of life is much more about cooperation, and it's the cooperation that comes first.&lt;br /&gt;&lt;br /&gt;If you think of the huge numbers of cooperative interactions that must occur in the subset of&amp;nbsp; pop-bead strings that are involved in most individual biological traits, and that many different sets of strings can generate similar outcomes, then you can also see that, a cooperation-based view of life explains why even when natural selection is screening a function, there can be many ways to pass the screen, and any specific part of the system may be only very weakly affected by the selection.&amp;nbsp; That's why even when selection leads to specific functional adaptations, it's very hard to find solid evidence for it at the gene (pop-bead) level.&lt;br /&gt;&lt;br /&gt;Again, understanding the nature of complex cooperation on which life is based, makes things fall into place more naturally than the oversimplified, competition-centered, often single-bead-focused view of life, that is so commonplace even among biologists (and certainly in the biomedical research world).&amp;nbsp; This is all ever so simple, and there's nothing secret or revolutionary about it. It's information available to anyone who wants to pay attention.&amp;nbsp; We think it's very important and that's largely why we wrote our book MT, to show its implications in detail.&lt;br /&gt;&lt;br /&gt;Life is a polymer phenomenon.&lt;br /&gt;&lt;i&gt;&lt;/i&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-3073107896936222866?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/3073107896936222866/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/polymers-not-so-secret-secret-of-life.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3073107896936222866'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3073107896936222866'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/polymers-not-so-secret-secret-of-life.html' title='Polymers: the not-so-secret Secret of Life.  Part II.  How it works'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/-y8UN49u3Y7w/Tv78-50TvYI/AAAAAAAAAH8/Pk1DDI6tksA/s72-c/popbeads.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-725076621379955108</id><published>2012-01-06T05:10:00.002-05:00</published><updated>2012-01-06T05:10:00.458-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='James Crow'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='population genetics'/><title type='text'>In Memoriam: Jim Crow</title><content type='html'>On January 3rd, James F Crow died, at the ripe old age of 95.&amp;nbsp; Jim was one of the 20th century's most prominent population geneticists, training many other leaders in the field as well as providing much of the evolutionary theory we have today.&amp;nbsp; Madison, Wisconsin must be a healthy place to live because, among other things, Jim's predecessor and one of the ultimate founders of population genetics, Sewall Wright, lived and passed away there.&amp;nbsp; Wright lived til he was just shy of his 100th birthday, so perhaps Madison is just too tough a place to make it all the way.&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-mI3dhWPTye4/TwXd_BVQkwI/AAAAAAAAAIU/ZRWFIArYRVY/s1600/Crow.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" src="http://1.bp.blogspot.com/-mI3dhWPTye4/TwXd_BVQkwI/AAAAAAAAAIU/ZRWFIArYRVY/s1600/Crow.jpg" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;I knew Jim from several meetings, though not as a close friend.&amp;nbsp; But all of us in our generation were weaned on Crow and Kimura (the latter, a founder of the 'neutral' theory of evolution as a counterweight to the prevailing strongly selectionist view, was a Crow student).&amp;nbsp; Many other of our most prominent population geneticists trained or worked with him.&amp;nbsp; His Wiki page stresses his role in teaching, suggesting it may have been his most important single contribution.&amp;nbsp; If one includes his books, and his very clear arguments about various subjects in his papers, then it would be hard to argue with that.&lt;br /&gt;&lt;br /&gt;Crow may not be known for many specific major theorems or the like, but he worked extensively on the nature of natural selection and how to detect evidence of it, on the way interactions among genes were (or, he might insist) were not reflected in adaptive evolution, on the age effect of fathers on disease risk in their children, and on human population variation--these being things I knew him for (he also did experimental and fruit-fly work).&lt;br /&gt;&lt;br /&gt;Jim Crow was personally a gentle man and a gentleman.&amp;nbsp; He was well-rounded personally and in his family.&amp;nbsp; I cribbed the picture, showing him playing the viola as he did for the Madison Symphony,&amp;nbsp; from John Hawkes' very fine &lt;a href="http://johnhawks.net/weblog/%20"&gt;post&lt;/a&gt;, where you can learn more about Crow (John is at Wisconsin).&lt;br /&gt;&lt;br /&gt;As I personally witnessed, he could defend a point of view in discussions, but I never knew him to become aggressive about it, nor &lt;i&gt;ad hominem, &lt;/i&gt;even when his protagonist was a bully (something I myself witnessed, the bully being alpha male Jim Neel).&amp;nbsp; He stuck to polite consideration of issues--even though he did have his points of views!&lt;br /&gt;&lt;br /&gt;Like the other famous Jim (Watson), Crow did hold some views about human variation, that (I think) in naive ways conflated the facts that we're all genetically different, that genes affect our traits, with group (i.e., 'race') differences.&amp;nbsp; But we all have our blinders.&lt;br /&gt;&lt;br /&gt;In his later, retired years, Jim continued to contribute and one noteworthy way was his editing of a column of retrospectives that ran in each issue of the prominent journal &lt;i&gt;Genetics&lt;/i&gt;.&amp;nbsp; These looked back at major issues and historical figures in ways that might not be widely known among younger readers for whom history was not considered a very important part of science.&lt;br /&gt;&lt;br /&gt;Jim had nowhere near the name-recognition of the great triumvirate of&amp;nbsp; population genetics, Wright, JBS Haldane, and RA Fisher.&amp;nbsp;&amp;nbsp; In recent years, I've found that people in genetics often have not heard of him (to their knowledge).&amp;nbsp; But even the great troika, along with other giants in science of their time, are no longer remembered by name.&amp;nbsp; And Jim had the kind of career, and of kindness, that should satisfy anyone in or out of science.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-725076621379955108?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/725076621379955108/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/in-memoriam-jim-crow.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/725076621379955108'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/725076621379955108'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/in-memoriam-jim-crow.html' title='In Memoriam: Jim Crow'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-mI3dhWPTye4/TwXd_BVQkwI/AAAAAAAAAIU/ZRWFIArYRVY/s72-c/Crow.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-3919949711534407922</id><published>2012-01-05T05:11:00.000-05:00</published><updated>2012-01-05T05:11:00.084-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='polymers'/><category scheme='http://www.blogger.com/atom/ns#' term='DNA'/><category scheme='http://www.blogger.com/atom/ns#' term='In Our Time'/><category scheme='http://www.blogger.com/atom/ns#' term='macromolecules'/><category scheme='http://www.blogger.com/atom/ns#' term='cooperation'/><title type='text'>Polymers and the not-so-secret secret of life.  Part I  The key properties of polymers</title><content type='html'>&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-MUHiPHaxrek/TwMaYOvb_KI/AAAAAAAACOY/hIpQgvy39So/s1600/300px-ProteinStructure.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="128" src="http://2.bp.blogspot.com/-MUHiPHaxrek/TwMaYOvb_KI/AAAAAAAACOY/hIpQgvy39So/s200/300px-ProteinStructure.jpg" width="200" /&gt;&lt;/a&gt;&lt;/div&gt;The Dec 29th installment of one of our favorite BBC programs, the&amp;nbsp;&lt;a href="http://www.bbc.co.uk/radio4/features/in-our-time/"&gt;Radio4 program,&amp;nbsp;&lt;i&gt;In Our Time&lt;/i&gt;&lt;/a&gt;,&amp;nbsp;was&amp;nbsp;a very understandable and informative discussion of macromolecules.&amp;nbsp; Mostly it's about macromolecular &lt;i&gt;polymers&lt;/i&gt;, that is, long strings, atoms or submolecules, consisting sometimes of millions of such units--things like plastics, polysaccharides, starches, and so on, but some of the discussion links the concepts to proteins, with a brief mention of DNA and RNA.&lt;br /&gt;&lt;br /&gt;The discussion is largely about industrial synthesis of macromolecules for various purposes, and is very interesting in its own right.&amp;nbsp; It only briefly mentions the fact that life is driven not just by polymers but also mentions something that is fundamentally important to life: unlike other polymers that are strings of the key polymers in life, proteins and nucleic acids (DNA and RNA) are composed of &lt;i&gt;different&lt;/i&gt; molecules strung together to work as one.&amp;nbsp; Therein lies the secret of life even if its so un-secret that every biologist knows it very well, and its even taught in good high school biology courses.&amp;nbsp; Yet this not-so-secret seems to have been badly under-appreciated when it comes to understanding a basic fundamental aspect of life, much more pervasively important than natural selection (we feel), and that underlies what we mean when we say that life is all about &lt;i&gt;cooperation&lt;/i&gt;.&amp;nbsp; That's one of our hobby-horses, a main them in our book, and one we perhaps too often bore MT readers with.&lt;br /&gt;&lt;br /&gt;In our usage, 'cooperation' is a double entendre.&amp;nbsp; First, we use it as an antidote to the cavalier way in which so many biologists and popular writers invoke Darwin and view the world thoroughly in terms of competition.&amp;nbsp; But secondly, we use the term in its less provocative connotation, but its more literal meaning of co-operation (the word used to be written in a way that denotes this origin: coöperation).&amp;nbsp; Cooperation means things work when they work together, and nothing reflects and, indeed, enforces this more than the polymer nature of DNA, RNA, and proteins.&lt;br /&gt;&lt;br /&gt;These macromolecules are strings of choices of different molecules rather than repeats of the same.&amp;nbsp; In DNA and RNA its a choice among the 4 nucleotides (A,C,G, and T [U in the case of RNA]).&amp;nbsp; Proteins are strings of amino acids, of which cells have 20 to pick from, and which DNA codes for in specifying protein structure.&amp;nbsp; Three key facts are key to making life a phenomenon of cooperation.&lt;br /&gt;&lt;ul&gt;&lt;li&gt;First, the &lt;i&gt;length&lt;/i&gt; of the strings is basically not limited.&amp;nbsp; A DNA molecule (chromosome) can be hundreds of millions of nucleotides long.&amp;nbsp;&lt;/li&gt;&lt;li&gt;Second, it is the &lt;i&gt;arrangement&lt;/i&gt; and order of these chosen units that give them their properties, which function because&lt;/li&gt;&lt;li&gt;Third, the arrangement of the sequence determines the function of that sequence because of the way the elements interact with other molecules.&lt;/li&gt;&lt;/ul&gt;These three properties of polymers make life a polymer phenomenon.&amp;nbsp; As we went into at length in our book MT, this is because of the way that the chemical 'shape' of the arrangement determines what the molecule will interact with, either among parts of the same long snake of a the protein or RNA, or between it and other molecules.&amp;nbsp; A protein or RNA molecule fold up upon themselves into a shape, and with properties, that depend on the location of the various different 'beads' in their string, because these 'beads' can chemically attract or repel each other.&amp;nbsp; And DNA functions by similar matching of its particular sequence of nucleotides with other molecules that can recognize the sequence and bind to the DNA.&amp;nbsp; Without this kind of interaction DNA and even protein molecules are not 'alive' and don't do anything.&amp;nbsp; Indeed, the way the universe is assembled, &lt;i&gt;doing &lt;/i&gt;something means interactions.&amp;nbsp; Interactions--cooperation--is the very essence of life.&lt;br /&gt;&lt;br /&gt;So we've gone on long enough here.&amp;nbsp; We'll just finish by saying that interaction in this context is what makes life what it is which is why we stress cooperation, as we'll discuss in Part II.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-3919949711534407922?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/3919949711534407922/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/polymers-and-not-so-secret-secret-of.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3919949711534407922'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/3919949711534407922'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/polymers-and-not-so-secret-secret-of.html' title='Polymers and the not-so-secret secret of life.  Part I  The key properties of polymers'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-MUHiPHaxrek/TwMaYOvb_KI/AAAAAAAACOY/hIpQgvy39So/s72-c/300px-ProteinStructure.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-5792400397522463565</id><published>2012-01-04T05:06:00.005-05:00</published><updated>2012-01-05T07:17:39.294-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='violence'/><category scheme='http://www.blogger.com/atom/ns#' term='Steven Pinker'/><category scheme='http://www.blogger.com/atom/ns#' term='public intellectuals'/><title type='text'>The law of the Conservation of Violence</title><content type='html'>Our society loves to crown celebrities around whom they can fawn and with whom there can be a mutual rewarding interaction.&amp;nbsp; We do it in theater, sports, politics, and even in science.&amp;nbsp; We're not referring here to Darwin or Newton who scientists themselves recognize as stars, but more public figures, and recently they'd include Richard Dawkins, Carl Sagan, Jared Diamond, Steven J Gould and....well, you can name the others of your choice.&lt;br /&gt;&lt;br /&gt;The phenomenon of public intellectuals is not new.&amp;nbsp; In science there were Robert Boyle and Thomas Edison, for example, who went around giving shows of their gadgets and discoveries, and whose note extended beyond a tiny upper crust of society.&amp;nbsp; But our rapid-media age has accelerated and exaggerated this phenomenon.&amp;nbsp; Once dubbed a public intellectual, the fortunate honorees are credited with expert knowledge in almost any area upon which they wish to pontificate.&amp;nbsp; That they usually are not really qualified in many of these areas is probably correct, but it may be equally correct that in many areas there aren't really any experts no matter how formally qualified they may seem to be (to wit: economists).&lt;br /&gt;&lt;br /&gt;One of the inductees into the Hall of Science Oracles these days is Steven Pinker, the Harvard psychologist. His recent book, &lt;i&gt;The Better Angels of Our Nature&lt;/i&gt;, argues that society has been steadily evolving more peaceful ways of living, starting with the Hobbesian brutality of hunter-gatherers and leading to our own serene societies today (note: several nations we might name need not apply).&amp;nbsp; A central point is that there has been a trend in which the &lt;i&gt;probability&lt;/i&gt; of dying by violence has been declining.&lt;br /&gt;&lt;br /&gt;Our comments here are reactions to extracts and the publicity the book's story-line has been getting and some comments we have heard from the author on interviews.&amp;nbsp; Some reviews seem to have been uncritically laudatory while others have been more negative, but the subject is inherently more one of opinion than actual science in the proper sense of the term, given the vagaries and subjectivity of data chosen to be included, not to mention what one means by our 'nature'.&lt;br /&gt;&lt;br /&gt;Still, to claim long-term trends that even extend to human evolution (or, at least, the hundreds of thousands of years of cultural evolution), is to make a strong claim.&amp;nbsp; Can one forgive a bit of acknowledging but then essentially dismissing, by an author born in 1954, a few years after Hitler and one year after the death of the arch-pacifist Stalin, for seeing things as being basically serene?&amp;nbsp; Even then it's hard to argue for the triumph of our better nature in the face of napalm in Viet Nam, gassing of Kurds, holocausts in Mao's Great Leap Forward in China, and in Laos, the former Yugoslavia and in Sudan, the Iran-Iraq war, and, well, you can flesh out the list for yourself.&amp;nbsp; Our better nature on display for all to see!&lt;br /&gt;&lt;br /&gt;I've just been reading books by Vasily Grossman (1905-1964), a Soviet journalist who wrote sobering novels including &lt;i&gt;Life and Fate&lt;/i&gt;, and &lt;i&gt;Everything Flows&lt;/i&gt;, about Hitler, but mainly Stalin and Lenin and what happened during their era.&amp;nbsp; Despite pulling no punches about what happened, Grossman nonetheless has a positive almost Pinkeresque view that human goodness and the drive for freedom will eventually win out.&amp;nbsp;&amp;nbsp; He attributes this to local, individual acts of kindness and generosity, if not,&amp;nbsp; as Pinker does, to societal structures.&lt;br /&gt;&lt;br /&gt;Grossman originally trained as a physicist and his books often refer to things in science.&amp;nbsp; One of his characters in &lt;i&gt;Everything Flows&lt;/i&gt; has a different view, proclaiming proclaims that whereas physics has its fundamental law of the Conservation of Energy, human life has its law of the Conservation of Violence:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;"History is simply a molecular process.&amp;nbsp; Man is always equal to himself, and there is nothing that can be done with him.&amp;nbsp; There is no evolution.&amp;nbsp; There is one very simple law, the law of the conservation of violence....Violence is eternal, no matter what is done to destroy it...it can only change shape...can be embodied in slavery or the Mongol invasion.&amp;nbsp; It wanders from continent to continent.&amp;nbsp; Sometimes it takes the form of class struggle, sometimes of race struggle....sometimes it is directed against colored people, sometimes against writers and artists, but, all in all, the total quantity of violence on earth remains constant.&amp;nbsp; Thinkers mistake its constant chaotic transformations for evolution and search for its laws.&amp;nbsp; But chaos knows no laws no evolution, no meaning, and no aim."&lt;/blockquote&gt;Grossman lived through the Soviet horrors of the mid-20th century, when such subjects were being discussed by eyewitnesses to untold horrors, an era chronicled by other famous authors as well, of course (And as far as trends go, there hadn't seemed to be that much angelic progress from Dostoyevsky (&lt;i&gt;House of the Dead, 1860&lt;/i&gt;)). These horrors are still in living memory (if not Pinker's).&amp;nbsp; And what of this velvet evolution as manifest, say, in the nonjudicial imprisonment  in Burma, China, or Palestine, imposed by former oppressed people  apparently not learning the appropriate progressive lesson from their better nature.&amp;nbsp; Not to worry, the &lt;i&gt;numbers&lt;/i&gt; are small, and let's not count these events (except maybe the interrogation beatings?) as 'violence'.&lt;br /&gt;&lt;br /&gt;All acknowledged jealousy about who gets to be rewarded as a public  intellectual aside, Pinker's thesis seems simplistic or naive in many ways, anthropologically and otherwise.&amp;nbsp; His book title is from Lincoln's phrase from his 1861 inaugural address at the beginning of the Civil War, right before the 'better angels of our nature' led to one of the worst and most systematic slaughters in human history (though we didn't invent scorched earth tactics).&lt;br /&gt;&lt;br /&gt;The idea of our 'nature' is rather vague.&amp;nbsp; One can't dispute that we are capable of kindness and peaceful coexistence, just as we're capable of violence.&amp;nbsp; Culture affects behavior, and its structures can encourage or discourage internal or external violence, and so on.&amp;nbsp; Culture obviously reflects and plays upon, the various types of behavior and responses our brains make possible.&amp;nbsp; But violence like other aspects of our behavior is largely based on perception, emotion, and so on, and there is not serious evidence that we are 'naturally' violent or 'peaceful' independent of circumstances.&lt;br /&gt;&lt;br /&gt;It is plausible or even likely reasonable, though rather unprovable in terms of anything that counts as science, that societies of millions, or billions of people, and a world increasingly interconnected by increasingly rapid travel and communication, may dampen individual-on-individual violence, or systematic lethal conflict to local areas or battlefields that spare major population areas.&amp;nbsp; By itself that is certainly good.&amp;nbsp; Of course, the effect would to have had to have arisen after, say, Hiroshima and Dresden and some communities in Sudan, etc.&amp;nbsp; I guess we've civilized since we, as state policy, scourged so many Amerindian tribes.&amp;nbsp; One has to decide whether the &lt;i&gt;percent&lt;/i&gt; who die that way, rather than, say, the &lt;i&gt;number&lt;/i&gt; or the way they die, is the cogent kind of data. &lt;br /&gt;&lt;br /&gt;But given that world-war savagery and holocausts did involve large scale slaughter, in living memory (if not Pinker's), and that there are increasing numbers of nuclear weapons at the ready, one has to be rather glib to assert that the push of a single button can't unleash previously unknown horrors.&amp;nbsp; Even then, in terms of percent killed, the number may be smaller than his (disputed) estimates of life in hunter-gatherer bands or some mythical biblical massacres.&amp;nbsp; It is rather vacuous to attribute that smaller number to our 'better angels', even if it were statistically true that massive conflict's casualties in the millions are only a small percent of the whole and we have evolved culturally so we'll never again melt cities.&lt;br /&gt;&lt;br /&gt;And, if at least part of the explanation for declining numbers of deaths is the better-angels idea of Mutually Assured Destruction (MAD) and the deterrent effect of knowing that nuclear weapons could obliterate us in even a single tit-for-tat push of those buttons, that's not exactly a paean to an angelic nature.&amp;nbsp; Does anyone seriously  believe that can't happen?&amp;nbsp; Would a MAD event be dismissed as just another quirky blip on the curve, or if it occurs would someone (else, or even Dr  Pinker himself, if he survives) exploit the moment to write a  revision and explain why our lesser angels suddenly took charge again?&lt;br /&gt;&lt;br /&gt;Why would anyone believe that there &lt;i&gt;was &lt;/i&gt;such a 'curve' of any scientific value?&amp;nbsp; It may be good  marketing, but seems rather superficial to argue  that we've become a species of kindly pacifists--especially if one  chooses a blind eye to systematic inequities in which we are guilty of participating right now.&amp;nbsp; Or even to argue that only European culture, in particular, has been wise enough to do that.&amp;nbsp; If that's our nature, and other cultures are as old as Europeans, why hasn't their nature asserted itself?&amp;nbsp; If you think very seriously about world affairs today it's rather  difficult to perceive any difference in our emotional responses, even if  we're not (all) dropping bombs on each other. &lt;br /&gt;&lt;br /&gt;For example, what about the increasing inequality in the world, that puts more people in poverty than ever in history?&amp;nbsp; What about the 'better angels' that lead us to have two or more cars apiece, and huge TV sets, while millions starve?&amp;nbsp;&amp;nbsp; Or investment bankers banking bonuses in the millions in New York while the streets of New York are palpably inhabited by hordes barely making ends meet?&amp;nbsp; What kind of wingless angels are responsible for that?&amp;nbsp; Or for the systematic pillage of the quality of life, if not the lives themselves, of indigenous people the world over?&amp;nbsp; Or the random slaughter by suicide bombers because--speaking of angels!--of religion.&lt;br /&gt;&lt;br /&gt;The law of the Conservation of Energy doesn't say that energy always has the same form.&amp;nbsp; A hot object can diffuse its energy into cooler surroundings.&amp;nbsp; Likewise violence takes many forms.&amp;nbsp; This is soft violence, the entropic spread referred to as the Conservation of Violence. A hot war can diffuse its violence into a surrounding &lt;i&gt;favela&lt;/i&gt;.&amp;nbsp; If you were starving you might consider that to be a form of degrading violence.&amp;nbsp; Is it unfair to suggest that if you are a well-paid professor making the lecture circuit to promote your book, and you want to sell glib ideas, it may not be in your interest to see that diffused violence for what it is?&lt;br /&gt;&lt;br /&gt;Conservation of Violence is only a rhetorical device, and we're not here suggesting it literally as any sort of 'law',&amp;nbsp; but it makes as much sense as a potential guide to thinking about human life.&amp;nbsp; Our point&amp;nbsp; is not just a critique of a popular science book but of the tendency to accept, as science, assertions that go far beyond appropriate criteria, a common point that we try to make on MT.&lt;br /&gt;&lt;br /&gt;For example, why not take as a working argument about human 'nature' that if culture keeps us from struggling for  dominance by physical slaughter, we weaken and disperse the weaponry from lead  bullets to bullets of trade and banking agreements and the like, that have a  slower, but chronic effect on many &lt;i&gt;more&lt;/i&gt; people.&amp;nbsp;&amp;nbsp;That by making violence masquerade as normal business, by passing laws that make it &lt;i&gt;legal&lt;/i&gt;, we are imposing even more violence upon our species?&amp;nbsp; Of course, given the misery that most people have had to live in, perhaps especially since the invention of stratified agricultural societies, maybe there really isn't anything new under the sun.&amp;nbsp; Perhaps it is mechanization and industrialization that were the blip, a few centuries or milennia of concentration of violence, heated to the point where entropy has come in temporarily to cool the temperature.&amp;nbsp; We're playing with fire to congratulate ourselves as if we've finally learned to cool our otherwise innate tempers.&lt;br /&gt;&lt;br /&gt;This, perhaps is just what the law of Conservation of Violence would predict.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-5792400397522463565?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/5792400397522463565/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/law-of-conservation-of-violence.html#comment-form' title='5 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/5792400397522463565'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/5792400397522463565'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/law-of-conservation-of-violence.html' title='The law of the Conservation of Violence'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>5</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-723764409973070019</id><published>2012-01-03T18:50:00.002-05:00</published><updated>2012-01-03T18:53:38.738-05:00</updated><title type='text'>CoE #43</title><content type='html'>Carnival of Evolution #43 is up and running at&lt;a href="http://evol-eco.blogspot.com/2012/01/carnival-of-evolution-43.html"&gt;&amp;nbsp;the EEB &amp;amp; flow.&lt;/a&gt;&amp;nbsp; Check it out.&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://carnivalofevolution.blogspot.com/"&gt;&lt;img border="0" height="320" src="http://3.bp.blogspot.com/-uqhqknlkXiI/TwOUISktaJI/AAAAAAAACOk/CmwPUCvn8ZI/s320/CoEButton.jpg" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-723764409973070019?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/723764409973070019/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/carnival-of-evolution-43-is-up-and.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/723764409973070019'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/723764409973070019'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/carnival-of-evolution-43-is-up-and.html' title='CoE #43'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/-uqhqknlkXiI/TwOUISktaJI/AAAAAAAACOk/CmwPUCvn8ZI/s72-c/CoEButton.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-1248272970382002006</id><published>2012-01-03T05:08:00.002-05:00</published><updated>2012-01-03T09:25:12.006-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='birds'/><category scheme='http://www.blogger.com/atom/ns#' term='numerosity'/><category scheme='http://www.blogger.com/atom/ns#' term='facultativeness'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='counting'/><title type='text'>Hey!  Who you callin' a bird brain??</title><content type='html'>What's all this about how stupid chickens are, or that they're just as smart with their heads chopped off?  We arrogantly refer to our dimmer fellow humans as bird-brains, but perhaps this is a case of the pot calling the kettle black.  At least, new work on bird smarts reinforces other work that we've talked about, and it's humbling.&lt;br /&gt;&lt;br /&gt;It turns out that pigeons are as smart as monkeys--and that's getting pretty close to home!  At least when it comes to counting things when there are fewer than ten, according to a &lt;a href="http://www.sciencemag.org/content/334/6063/1664.full"&gt;paper&lt;/a&gt; in the Dec 23 Science, as &lt;a href="http://www.nytimes.com/2011/12/23/science/pigeons-can-learn-higher-math-as-well-as-monkeys-study-suggests.html?hp"&gt;reported&lt;/a&gt; in the NYT.   We &lt;a href="http://ecodevoevo.blogspot.com/2011/12/intelligent-bird-brain.html"&gt;blogged&lt;/a&gt; about smart corvids -- crows, jays, ravens and jackdaws -- and their sense of self a few weeks ago, but pigeons aren't corvids, and they're smart too?  Starts to sound like a trend.&lt;br /&gt;&lt;br /&gt;&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-9wQt-wDXcXg/TvoX2Lw_jhI/AAAAAAAACNc/v4TVY_Kt910/s1600/23pigeons-articleLarge.jpg" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" src="http://2.bp.blogspot.com/-9wQt-wDXcXg/TvoX2Lw_jhI/AAAAAAAACNc/v4TVY_Kt910/s200/23pigeons-articleLarge.jpg" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;&lt;span style="font-size: x-small;"&gt;Pigeons performing math tests.  When it pecks a shape, a box &lt;br /&gt;appears.  Photo from the &lt;a href="http://www.nytimes.com/2011/12/23/science/pigeons-can-learn-higher-math-as-well-as-monkeys-study-suggests.html?hp"&gt;New York Times&lt;/a&gt;. &lt;/span&gt;&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;Scarf and colleagues in the Psychology Department at the University of Otago in New Zealand write that humans are the only species that can count, because counting is a product of language and culture, but that this ability had to evolve from somewhere, an idea reinforced by the seeming ability of organisms from honeybees to chimps to "differentiate stimuli differing in numerosity, that is, the number of elements they contain."&lt;br /&gt;&lt;br /&gt;&lt;span style="font-size: small;"&gt;&lt;span style="font-family: Times,&amp;quot;Times New Roman&amp;quot;,serif;"&gt;As the authors note in their paper,&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span style="font-size: small;"&gt;&lt;span style="font-family: Times,&amp;quot;Times New Roman&amp;quot;,serif;"&gt;In a landmark study, &lt;/span&gt;&lt;/span&gt;&lt;a href="http://www.sciencemag.org/content/282/5389/746.abstract?ijkey=8ffc90b5e072ee7f8e83541d3ff5bd5677b8febc&amp;amp;keytype2=tf_ipsecsha"&gt;Brannon and Terrace&lt;/a&gt; showed that rhesus monkeys could not only discriminate stimuli differing in numerosity but that they could also acquire abstract numerical rules.&amp;nbsp; The monkeys were trained to order stimuli containing one, two, three, or four elements in ascending order.&amp;nbsp; To assess whether the monkeys had learned simple nominal categories or an abstract rule, Brannon and Terrace tested the monkeys with pairs of novel values outside of the training range.&amp;nbsp; The monkeys were able to order the novel pairs, suggesting that they had learned an abstract numerical rule that was not tied to the training numerosities (Fig. 1B).&amp;nbsp; In addition, the monkeys displayed distance effects, with accuracy increasing (Fig. 1C) and response latency decreasing (Fig. 1D) as the numerical distance between the paired items increased.&amp;nbsp; The monkeys' performance was dependent on the ration of the paired items (Fig. 1E).&amp;nbsp; As Brannon and Terrace noted, their data suggests that "monkeys represent numerosities 1 to 9 on an ordinal scale." &lt;br /&gt;&lt;br /&gt;&lt;/blockquote&gt;Further, &lt;br /&gt;&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span style="font-size: small;"&gt;Pigeons were trained to order 35 three-item numerical lists (Fig 1A). Each list contained stimuli consisting of one, two, or three elements, and subjects were trained to respond to them in ascending order. Subjects were then tested on pairs of numerosities drawn from the range of one to nine.&lt;/span&gt;&lt;/blockquote&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;span style="font-size: small;"&gt;&lt;a href="http://2.bp.blogspot.com/-TtYSn2e5arY/TwMKxX1X4aI/AAAAAAAACOA/_QiTDMvnCXE/s1600/Science+2011+Dec+334%25286063%2529+1664%252C+Fig.+1.jpg" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="239" src="http://2.bp.blogspot.com/-TtYSn2e5arY/TwMKxX1X4aI/AAAAAAAACOA/_QiTDMvnCXE/s320/Science+2011+Dec+334%25286063%2529+1664%252C+Fig.+1.jpg" width="320" /&gt;&lt;/a&gt;&lt;/span&gt;&lt;/div&gt;&lt;br /&gt;&lt;span style="font-family: &amp;quot;Times&amp;quot;,&amp;quot;serif&amp;quot;; font-size: 10pt; line-height: 92%;"&gt;(A)Stimulus sets used in training. (B) Performance on the test pairs. Error barsindicate SEM. (C) Accuracy as a function of distance. (D) Response latency as afunction of distance. (E) Accuracy as a function of ratio. The dashed linesrepresent the best-fit linear models. Pigeons (N = 3) completed 10 testsessions. The monkey data were redrawn from &lt;a href="http://www.sciencemag.org/content/282/5389/746.abstract?ijkey=8ffc90b5e072ee7f8e83541d3ff5bd5677b8febc&amp;amp;keytype2=tf_ipsecsha"&gt;&lt;span style="color: blue;"&gt;Brannon and Terrace&lt;/span&gt;&lt;/a&gt;.&lt;/span&gt;&lt;br /&gt;&amp;nbsp; &lt;br /&gt;&lt;span style="font-size: small;"&gt;That is, they trained some pigeons to peck images on a computer screen, in order, from the smallest to the largest number. And, it turned out that the pigeons did this just as well as monkeys.  The authors suggest that there are one of two explanations for this -- it's either convergent evolution, that is, numerosity evolved independently in both lineages, or numerical competence derived from an ancestor shared by both birds and primates.  This would have been a common ancestor about 300 million years ago, before dinosaurs and mammals.  So long ago as to seem unlikely, which is why Dr Scarf says that if he had to guess he'd say the trait evolved separately in birds and primates.&amp;nbsp;&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-size: small;"&gt;But hold on.  Alfred Russel Wallace, co-discoverer of evolution by natural selection with Charles Darwin, got off the boat when it came to the evolution of the human brain because he couldn't understand how humans could do something like calculus when calculus wasn't around when the brain would have been evolving.&amp;nbsp; That is, he believed we could do things that we couldn't possibly have been selected to do, like calculus, or music.  His conclusion was that therefore God must have made us.  But this is incorrect.  Apparently by similar logic -- that is, incomplete understanding of evolution -- the ability of birds and primates to count must be because they evolved a specific ability to do so, and that has to be explicable.  But what about ants?  They don't do calculus, but they do calculate; Darwin himself marveled at the remarkable problem-solving abilities of ants, with their pin-point sized brains. How can this be? Does numerosity have to be a trait that itself evolved?  &lt;br /&gt;&lt;br /&gt;&amp;nbsp;As we've said numerous times before, one trait that arose so early in evolution that probably all organisms have it is facultativeness, the ability to adapt to changing circumstances, such as temperature, or food supply.  Facultativeness also means the ability to learn, from concrete things like finding and exploiting new food sources to abstract things like learning how to read, or in the case of these pigeons, how to count.  &lt;br /&gt;&lt;br /&gt;The brain is a prime example.  The human brain has the ability to make sense of all sorts of things we've never seen before, never mind that didn't exist when it was evolving, and the same can be said for the brains of ants and bees and birds and non-human primates.  Birds are currently being found or trained to do all sorts of things no one thought they had any right to be able to do, from tool use to understanding that another bird might steal cached food, and now to having an ordinal sense.  &lt;br /&gt;&lt;br /&gt;There are limits, we hasten to add -- even if they had the hardware to do so, non-human primates aren't ever going to be as prolific with language as we are, no matter how diligently they're trained.  Even if orangs can learn to use iPads.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-size: small;"&gt;&lt;iframe allowfullscreen="" frameborder="0" height="315" src="http://www.youtube.com/embed/3KGrXZ5pWko" width="560"&gt;&lt;/iframe&gt;&lt;br /&gt;&lt;/span&gt;&lt;br /&gt;&lt;span style="font-size: small;"&gt;&lt;br /&gt;&lt;/span&gt;And birds aren't going to reinvent calculus. We're straying far afield here, but we assume the limits are largely a function of the structure of the brain and its synapses. But the fact that there are constraints doesn't mean that brains evolved to meet only the specific problems and challenges that the early ancestors of birds, ants or humans had to confront early in our evolution. &lt;br /&gt;&lt;br /&gt;Undoubtedly there are many genetic pathways shared between us, that are involved in neurotransmission systems, as is the case with genes associated with light reception and many basic developmental genes, and much more. But problem solving undoubtedly involves many different genes and combinations of variants in those genes, even within a species--such as among humans (or ants), so that invoking 'parallel' evolution for such a complex trait as problem-solving may stretch the idea of any precise homology.&lt;br /&gt;&lt;br /&gt;We see no need to invoke specific separate adaptive scenarios for the ability to count in birds and mammals (and ants). What evolved, perhaps, was 'just' the ability to assess environments and make decisions about them. Counting and ordinal relationships may be a specific ability or a manifestation of general problem-solving; we're not qualified to judge that (JohnV?).   But general problem-solving would be involved in survival, for sure, and the more general problem-solving ability is, perhaps the more robust in terms of survival.&lt;br /&gt;&lt;table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"&gt;&lt;tbody&gt;&lt;tr align="left" style="font-family: Times,&amp;quot;Times New Roman&amp;quot;,serif;"&gt;&lt;td class="tr-caption"&gt;&lt;span style="font-family: &amp;quot;Times&amp;quot;,&amp;quot;serif&amp;quot;; font-size: 10pt; line-height: 92%;"&gt;&lt;/span&gt;&lt;/td&gt;&lt;td class="tr-caption"&gt;&lt;br /&gt;&lt;/td&gt;&lt;td class="tr-caption"&gt;&lt;span style="font-family: &amp;quot;Times&amp;quot;,&amp;quot;serif&amp;quot;; font-size: 10pt; line-height: 92%;"&gt;&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-1248272970382002006?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/1248272970382002006/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/hey-who-you-callin-bird-brain.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1248272970382002006'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1248272970382002006'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/hey-who-you-callin-bird-brain.html' title='Hey!  Who you callin&apos; a bird brain??'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-9wQt-wDXcXg/TvoX2Lw_jhI/AAAAAAAACNc/v4TVY_Kt910/s72-c/23pigeons-articleLarge.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-1983197080865761845</id><published>2012-01-02T05:07:00.000-05:00</published><updated>2012-01-02T13:19:16.255-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='genetics'/><category scheme='http://www.blogger.com/atom/ns#' term='epidemiology'/><category scheme='http://www.blogger.com/atom/ns#' term='confounding'/><category scheme='http://www.blogger.com/atom/ns#' term='complexity'/><category scheme='http://www.blogger.com/atom/ns#' term='acetaminophen'/><category scheme='http://www.blogger.com/atom/ns#' term='asthma'/><category scheme='http://www.blogger.com/atom/ns#' term='association studies'/><title type='text'>Those confounded links to the causes of asthma</title><content type='html'>We've blogged a number of times about asthma -- specifically, why has it increased in prevalence so dramatically over the last 30 years, and why hasn't epidemiology figured it out? &amp;nbsp;(Here's our most recent &lt;a href="http://ecodevoevo.blogspot.com/2011/11/understanding-pathways-leads-to-drug.html"&gt;post&lt;/a&gt;&amp;nbsp;on this, and here's &lt;a href="http://ecodevoevo.blogspot.com/2011/02/are-we-too-clean-hygiene-hypothesis-and.html"&gt;one&lt;/a&gt; on the Hygiene Hypothesis.) A disease that goes from not so common to very common very quickly most likely has an environmental trigger. &amp;nbsp;It's unlikely to be some new genetic risk, because genes don't change that quickly, and it's likely to be an environmental cause with a major effect, since it's triggering the disease in a whole lot of people. &amp;nbsp;And, since epidemiology is best at figuring out major environmental effects -- smoking, infectious agents, um.... &amp;nbsp;-- you'd think they'd have knocked this one long ago. &amp;nbsp;But no, the answer to why so many kids are getting asthma has been elusive. &amp;nbsp;Until maybe now. &lt;br /&gt;&lt;br /&gt;But, let's back up. &amp;nbsp;Millions -- and millions -- of dollars have been spent on the genetics of asthma. &amp;nbsp;Numerous family studies, GWAS (genomewide association studies), admixture mapping studies, and so on, and nothing to explain any significant amount of variation in risk has yet been found. &amp;nbsp;The idea was -- we guess -- that while asthma was certainly increasing in prevalence, not everyone was getting it, and the explanation for &lt;i&gt;that&lt;/i&gt; must be genetic. &amp;nbsp;Let's ignore the root cause, whatever had changed in the environment, and just explain why some people respond to whatever-it-is with asthma.&amp;nbsp; Beyond our current fetish with geneticizing everything that moves, the rationale was that druggable pathways would be identified this way, and so whether or not we understood the source of the epidemic, by golly, we would be able to sell a lot of drugs to treat it. &lt;br /&gt;&lt;br /&gt;Ok, that's one approach.&lt;br /&gt;&lt;br /&gt;But to be fair, environmental and observational epidemiologists &lt;i&gt;did&lt;/i&gt;&amp;nbsp;try their darndest to tease out the environmental cause, and all they got for their pains were confusing and contradictory results. &amp;nbsp;Breast feeding, bottle feeding; environments that were too clean or environments that were too dirty; lack of helminth infections, lack of air pollution (really -- this was based on observations such as that asthma was on the increase in the early days of the epidemic in places like West Germany, but not right over the wall in East Germany, where air pollution was high). &amp;nbsp;We got the Hygiene Hypothesis out of all this work, a still live conjecture about the importance of boosting our immune systems when we're young. Maybe true.&lt;br /&gt;&lt;br /&gt;But now the asthma community has a new idea, and again to be fair, it's in part due to some good sleuthing by epidemiologists. &amp;nbsp;Actually, the idea isn't so new -- the first &lt;a href="http://www.ncbi.nlm.nih.gov/pubmed/9809499"&gt;paper&lt;/a&gt; suggesting it was published in 1998 -- but the idea is just now getting legs. &amp;nbsp;It's probably the most likely possible solution to the question of what's causing this epidemic that has been offered to date. &amp;nbsp;(Though we're still disappointed that no one picked up on our suggestion in a 2006 paper that the use of plastic diapers grew right along with the asthma epidemic, a correlation that we thought might do with some looking into.) And if this current suggestion is true, it shows again the problem of correlation not proving causation.&lt;br /&gt;&lt;br /&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;A&amp;nbsp;&lt;a href="http://www.nytimes.com/2011/12/20/health/evidence-mounts-linking-acetaminophen-and-asthma.html?scp=2&amp;amp;sq=asthma&amp;amp;st=cse"&gt;story&lt;/a&gt;&amp;nbsp;in the&amp;nbsp;&lt;i&gt;New York Times&lt;/i&gt;&amp;nbsp;reported on this recently.&amp;nbsp;The idea is that acetaminophen causes asthma. &amp;nbsp;In the 1980's, when the epidemic began, doctors started recommending that parents treat their infants' pain and fever with acetaminophen rather than aspirin because &lt;a href="http://www.reyessyndrome.org/aspirin.html"&gt;aspirin had been found to cause Reyes' Syndrome&lt;/a&gt;. &amp;nbsp;So, Tylenol sales took off. &amp;nbsp;And, not too long after that, so did inhaler sales. &amp;nbsp;More than 20 studies that show this association have now been published, and it's starting to look strong, not only based on epidemiological measures such as the strength of the association (the strength of the association between air pollution and low risk was strong too, but more on that below), but with a fairly substantial understanding of the biological mechanism that could explain the risk.&lt;/div&gt;&lt;br /&gt;Here's the abstract from a &lt;a href="http://pediatrics.aappublications.org/content/128/6/1181.abstract"&gt;paper&lt;/a&gt; in the November issue of &lt;i&gt;Pediatrics, &lt;/i&gt;by John McBride:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;i&gt;&lt;span class="Apple-style-span" style="color: #403838; font-style: normal; line-height: 19px;"&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;The epidemiologic association between acetaminophen use and asthma prevalence and severity in children and adults is well established. A variety of observations suggest that acetaminophen use has contributed to the recent increase in asthma prevalence in children: (1) the strength of the association; (2) the consistency of the association across age, geography, and culture; (3) the dose-response relationship; (4) the timing of increased acetaminophen use and the asthma epidemic; (5) the relationship between per-capita sales of acetaminophen and asthma prevalence across countries; (6) the results of a double-blind trial of ibuprofen and acetaminophen for treatment of fever in asthmatic children; and (7) the biologically plausible mechanism of glutathione depletion in airway mucosa. Until future studies document the safety of this drug, children with asthma or at risk for asthma should avoid the use of acetaminophen.&lt;/span&gt;&lt;/span&gt;&lt;/i&gt;&lt;/blockquote&gt;A somewhat more detailed description of the findings on JournalWatch is &lt;a href="http://pediatrics.jwatch.org/cgi/content/full/2011/1221/1"&gt;here&lt;/a&gt;.&lt;br /&gt;&lt;br /&gt;So, some in the pediatric community are starting to take notice, and recommend that parents give their kids ibuprofen rather than acetaminophen or aspirin. &amp;nbsp;Though, some are still doubtful; parents give their children acetaminophen when they have fevers, often of viral origin, and it could be the virus that causes asthma, not the treatment, some say. &amp;nbsp;Others are dubious because many of the studies relied on parents recalling how much of the drug they gave their children sometimes years in the past. &amp;nbsp;Relying on recall is a common cause of iffy results in epidemiological studies.&lt;br /&gt;&lt;br /&gt;In addition, according to the &lt;i&gt;Times&lt;/i&gt;,&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;So far, only one randomized controlled trial has investigated the link. Researchers at Boston University School of Medicine randomly assigned 1,879 children with asthma to take either acetaminophen or ibuprofen if they developed a fever. The results, published in 2002, showed that &lt;a href="http://www.ncbi.nlm.nih.gov/pubmed/11826230"&gt;children who took acetaminophen to treat a fever were more than twice as likely to seek a doctor’s care later for asthma symptoms&lt;/a&gt; as those who took ibuprofen.&lt;/blockquote&gt;Of course, these are children who already have asthma, which complicates the interpretation of causation, but it does suggest that the mechanism, glutathione depletion in airways, might indeed be involved (though see above). &amp;nbsp;What's really needed to confirm the role of acetaminophen is a prospective study of children from birth through childhood but the ethics of a study that involves giving acetaminophen to babies surely would be questionable at this stage.&lt;br /&gt;&lt;br /&gt;So, what about these other associations that looked so strong not long ago? &amp;nbsp;The idea that helminth infections or air pollution might actually reduce risk of asthma? &amp;nbsp;They could still be true, it could be that asthma, which is as complex and variable a disease as almost any disease out there, could have many causes. &amp;nbsp;Or, if the acetaminophen link is true, then these other factors are either independent confounders or in some way actively interact with the acetaminophen-related mechanism. &amp;nbsp;In rural African villages where helminths are a common fact of life, or in cities where air pollution is high, acetaminophen use is not. &amp;nbsp;The Hygiene Hypothesis, even given that people have suggested possible biological explanations for it, may be on its way out. &lt;br /&gt;&lt;br /&gt;If this association does explain the epidemic, there's still this question -- will geneticists stop looking for genes 'for' asthma? &amp;nbsp;We don't bet on it. &amp;nbsp;That's not to say that better treatment isn't needed, and that the triggers and responses need to be better understood because the biology is complex -- indeed, some say that every case is unique -- and asthma is often difficult to control. &amp;nbsp;But, continuing to search for genetic causation? &amp;nbsp;Bah, humbug.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-1983197080865761845?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/1983197080865761845/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/those-confounded-links-to-causes-of.html#comment-form' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1983197080865761845'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/1983197080865761845'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2012/01/those-confounded-links-to-causes-of.html' title='Those confounded links to the causes of asthma'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-7360115220532266724</id><published>2011-12-30T08:58:00.050-05:00</published><updated>2011-12-30T17:53:49.830-05:00</updated><title type='text'>The iron cage of preconception</title><content type='html'>We thought we'd let MT lay fallow today, in lazy anticipation of the turning of the year, when not many people are spending their time browsing blogs.&amp;nbsp; But now that we've seen this &lt;a href="http://www.bbc.co.uk/nature/16305600"&gt;story&lt;/a&gt;&amp;nbsp;on the BBC site we can't let it slide. &amp;nbsp;It's the report of an experiment that provides the missing link in the evolution of language.&amp;nbsp; Yes! &amp;nbsp;Can you believe it?. . . .&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;Researchers found that wild chimps that spotted a poisonous snake were more likely to make their "alert call" in the presence of a chimp that had not seen the threat.&lt;/span&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;This indicates that the animals "understand the mindset" of others.&lt;/span&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;The insight into the primates' remarkable intelligence will be published in the journal Current Biology.&amp;nbsp; How could &lt;i&gt;Nature&lt;/i&gt; and &lt;i&gt;Science,&lt;/i&gt; both hungry as they are for sensational stories, have missed this?&lt;/span&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;&lt;span class="Apple-style-span" style="color: #333333; line-height: 18px;"&gt;Matthew Cobb, professor of zoology at the University of Manchester, explained that "imagining what another individual is thinking" is a crucial part of human language.&lt;/span&gt;&amp;nbsp;&lt;/span&gt;&lt;/blockquote&gt;&lt;div&gt;&lt;/div&gt;&lt;div&gt;But, hold on.  Didn't we &lt;a href="http://ecodevoevo.blogspot.com/2011/12/intelligent-bird-brain.html"&gt;learn just last week&lt;/a&gt; that corvids could do the same?  Jays that see that they've been observed while hiding food later move it, because they apparently understand what the nearby jay is thinking, namely that when the hider leaves, he or she will get the hider's meal for free.  &lt;br /&gt;&lt;br /&gt;We are not criticizing this story itself, and indeed it seems both interesting and convincing.  But how can there still be surprise at, or doubt about, the ability of animals other than ourselves to have sophisticated mental and social lives?  Instead of trying to explain how, with their dullard brains, other species can do things we fancied that only our noble selves were up to, wouldn't an evolutionary perspective simply have expected this?&lt;br /&gt;&lt;br /&gt;&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://4.bp.blogspot.com/-G8q-EhLb7E4/Tv3DvvalqII/AAAAAAAACNo/Va-7Vjyz498/s1600/_57523524_img_2455.jpg" imageanchor="1" style="margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" height="111" src="http://4.bp.blogspot.com/-G8q-EhLb7E4/Tv3DvvalqII/AAAAAAAACNo/Va-7Vjyz498/s200/_57523524_img_2455.jpg" width="200" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;Chimp warning an uninformed mate&lt;br /&gt;about danger (from the BBC).&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;Species other than ourselves are hatched into complex, variable, threatening as well as beckoning Nature.  They have to perceive it, size it up, and decide how to manage their way through it.  They have the same sense organs we have, using very similar genes and genetic pathways -- some, such as light-perceiving mechanisms even shared between clams and humans.  &lt;br /&gt;&lt;br /&gt;We can debate who has 'consciousness' til the proverbial cows come home, and we know that many don't want to credit that to any species but ourselves.  That is a debatable, perhaps largely semantic, question, and humans are certainly very different from other species in this respect.  How and why it's not as different as it seems is a matter for another post or series of posts.  But the notion that individuals in other species can solve problems and size up things and respond to or communicate with each other should not be any sort of surprise, even if one might not be able in advance to predict all their instances or specifics.&lt;br /&gt;&lt;br /&gt;This reflects a persistent human exceptionalism but, we think, something more profound about the very same human culture that manifests this surprise.  It is that we are born into a culture that frames our world, and it is difficult to escape it.  The worldviews of a culture put a kind of iron cage around individuals, making it difficult to appreciate, or even 'get' other cultures.  This is a profound lesson of anthropology, though it seems to have been pretty much forgotten these days, with the prevalent opposition to notions of cultural relativism (that other cultures could be as true or valid ways to live as our own culture is).&lt;br /&gt;&lt;br /&gt;We like to fancy that science is an objective pursuit that is above such subjective constraints.  But scientists are inculcated with the same kind of conceptual cage.  We call it 'theory'.  It's long been recognized that it is difficult to get out of that cage, and in a sense it rarely happens (the term used for that is 'paradigm shift').  &lt;br /&gt;&lt;br /&gt;The conceptual cage of human exceptionalism is like that, we think.   The humans-only view is a cage that makes us oblivious or resistant to knowledge that is actually freely available, because that knowledge seems to challenge ideas that are the root of too much of our theory and the research that theory leads to, and the careers that are built on it.  This seems true even though evolution, which is at the heart of much of that theory, predicts connection as well as difference among species.&lt;br /&gt;&lt;br /&gt;Whether chimps (or crows) could understand the New York Times is perhaps not at issue -- and we've got another post waiting in the wings about bird brains.  Probably, they wouldn't want to--too many boring, self-interested stories about the trivial events in human society.  Chimps (and crows) have other things to deal with, and they pass the news to each other in their own ways. &lt;br /&gt;&lt;br /&gt;Have a very good New Year, everybody! &lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-7360115220532266724?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/7360115220532266724/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/iron-cage-of-preconception.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7360115220532266724'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7360115220532266724'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/iron-cage-of-preconception.html' title='The iron cage of preconception'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/-G8q-EhLb7E4/Tv3DvvalqII/AAAAAAAACNo/Va-7Vjyz498/s72-c/_57523524_img_2455.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-5418351571174841255</id><published>2011-12-29T05:57:00.000-05:00</published><updated>2011-12-29T05:57:00.540-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='irremediable complexity'/><category scheme='http://www.blogger.com/atom/ns#' term='irreducible complexity'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='cooperation'/><title type='text'>Irreducible Complexity....that might actually mean something!</title><content type='html'>The Intelligent Design people argue, among other things, that organisms manifest 'irreducible complexity' (IC hereafter) that cannot be explained by us 'evolutionists'.&amp;nbsp; They say that things like, say, our complex, focusing, camera-like eye, for example, can't have evolved one bit at a time, because the parts make no sense until the whole thing is put together.&amp;nbsp; In fact, this was an example chosen by Darwin to exemplify the potentially devastating explanatory problem that his theory of gradual evolution by natural selection posed.&amp;nbsp; Complex things simply can't arise out of thin air, by any process known to evolutionary biology, after all!&lt;br /&gt;&lt;br /&gt;The IC people are essentially arguing against spontaneous generation, one might naively think:&amp;nbsp; that was the idea, mooted about even by Aristotle, that a bit of goo and slop might come suddenly together and--poof!--arise as a ready-made organism, like a fly.&amp;nbsp; Of course famous experiments by Spallanzani in the 1700s (and &lt;a href="http://www.anthro.psu.edu/weiss_lab/CQ12_FrogInTaffetaPants.pdf"&gt;replicated&lt;/a&gt; by yours truly in one of my &lt;i&gt;Evolutionary Anthropology&lt;/i&gt; columns only a few years ago) clearly discredited that idea, showing that maggots may appear to arise in dead meat as if by spontaneous generation, but in fact that only happens if a fly happens to have, modestly, laid eggs in the meat.&lt;br /&gt;&lt;br /&gt;Darwin's fears were groundless, for two reasons.&amp;nbsp; First, he suggested some&amp;nbsp; possible paths from simple light perception to complex eyes.&amp;nbsp; And second is the minor fact that he has been shown to be right!&amp;nbsp; We now know that eyes of all sorts, simpler and more complex, have arisen many times independently, but usually sharing at least some developmental genetic basis, such as Pax genes in development and opsin genes in light-detection.&amp;nbsp; And, to assuage his worst fears, all sorts of 'intermediate' types of eyes and light-sensitivity have been found.&lt;br /&gt;&lt;br /&gt;Still, the IC campaign, a thinly disguised Christian biblical fundamentalism, carries on, apparently oblivious to its own manifest non-sensicallity.&lt;br /&gt;&lt;br /&gt;But there is another sense in which IC may be a more profoundly true and legitimate aspect of biology and consequence of evolution (maybe we should not use the abbreviation in this case).&amp;nbsp; A &lt;a href="http://www.sciencemag.org/content/330/6006/920"&gt;Commentary&lt;/a&gt;&amp;nbsp;by Gray et al. in the 12 November 2010 issue of &lt;i&gt;Science &lt;/i&gt;("Irremediable Complexity?", p 920-921, accessible with subscription), asks whether there may be, in fact, an aspect of irreducible complexity in living Nature. &amp;nbsp;(Yes, November 2010 -- I'm working my way through my "Urgent!" reprint stack this week!)&lt;br /&gt;&lt;br /&gt;The authors argue that some macromolecular processes in life seem to have "gratuitous complexity".&amp;nbsp; Among the examples they cite is the &lt;i&gt;spliceosome&lt;/i&gt;, the structure that takes a messenger RNA molecule copied from a DNA 'gene', and removes the non-coding sequences (introns) that interrupt the coding parts (the exons), and then splices the exons together to form the single protein code.&amp;nbsp; Why introns?&amp;nbsp; Why such a complex structure to do this?&amp;nbsp; How could organisms have evolved to need to spend--waste!--the energy (and hence needed food intake) to splice all their genes in all their cells all the time?&amp;nbsp; It's not necessary to life, as bacteria clearly show (they don't splice).&amp;nbsp; How inefficient!&lt;br /&gt;&lt;br /&gt;Strict Darwinian selectionism that is argued to optimize everything all the time must answer such questions, but the suggested answers are often as &lt;i&gt;post hoc&lt;/i&gt; and contorted as, well, as a spliceosome!&amp;nbsp; But Gray et al. argue that understandable evolutionary processes have integrated bits of the current structure over time (again contra the allegation of the IntelligentDesigners!).&amp;nbsp; Some steps, or perhaps the initial step may have evolved in the usual way for some reason that may or may not have been related to the current function in which the gene is used.&amp;nbsp;&amp;nbsp; Other steps may have arisen when causing no harm, or such trivial harm that in spite of that they became fixed in the genome by chance.&amp;nbsp; If they happened--'chanced'--to have some effect, say by binding to the strongly selected gene-products, that could have been integrated into the genome (fixed in the very ancient species involved), and then as a result been impossible to remove without harm.&amp;nbsp; Like a ratchet, step by step, complex structures could arise over zillions of years.&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-mVTrNx6BOGY/TvuK-sMU6xI/AAAAAAAAAHw/qjTILIb2ckU/s1600/Screen+Shot+2011-12-28+at+4.31.42+PM.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="265" src="http://1.bp.blogspot.com/-mVTrNx6BOGY/TvuK-sMU6xI/AAAAAAAAAHw/qjTILIb2ckU/s400/Screen+Shot+2011-12-28+at+4.31.42+PM.png" width="400" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;In this scenario, previously independent functions could become dependent, as illustrated in the figure from Gray et al.&amp;nbsp;&amp;nbsp; The two components arose on their own, for whatever reason, but mutationally later became hitched at the altar to form a new function or modify an existing one.&amp;nbsp; Once the marriage is made, it cannot be rent asunder by selection, yet neither was installed specifically by selection.&lt;br /&gt;&lt;br /&gt;This is the kind of partnership (what we call 'cooperation' in MT) that is so pervasive in life, indeed is so much at the core of how life works.&amp;nbsp; It is in no way incompatible with reproductive success--due to chance or selection--but it was not selected 'for' as is implied by classical Darwinian explanations.&amp;nbsp; It violates no principles of biology or evolution--and certainly doesn't constitute a 'paradigm shift'!&amp;nbsp; It's just plain old evolution.&lt;br /&gt;&lt;br /&gt;In this way, constructive evolution can also be selectively neutral evolution.&amp;nbsp; Racheted increasing complexity may be an important or even fundamental aspect of life.&amp;nbsp; We know from many examples that things once established can be removed or made simpler by mutation and selection, but ratched complexity can become so entrenched--so complex--that it can't just be disassembled in any old way to regain the beatific simplicity of its yesteryear.&lt;br /&gt;&lt;br /&gt;This of course has implications for selective arguments about evolution.&amp;nbsp; At the molecular level, complexity can be installed without specific strong or directional selection, and this can also be true at the organ or organismal level as well.&amp;nbsp; Selection on higher-level traits, like say, complex behaviors, could occur, even strongly, and yet be distributed over so many different contributing genes that none of them would show statistically detectable evidence of selection.&lt;br /&gt;&lt;br /&gt;Even behaviors could have evolved from simple to more complex, bit by bit, in the same ratcheted--neutral--way.&amp;nbsp; Behaviors, like problem solving, often integrate multiple systems including vision, hearing, olfaction and so on, just as spliceosomes and their ilk evolved in augmented, incremental ways.&amp;nbsp; Behaviors also involve perception, synthesis, strategizing, and choice of actions, each with its own only partially interdependent connections.&lt;br /&gt;&lt;br /&gt;A point we repeatedly harp on is that the evolution of organisms is the  evolution of multiply interacting factors that must cooperate to be  successful.&amp;nbsp; It builds piecemeal, and yet is 'reducible', even if we don't know all the details by any means.&amp;nbsp; But even if not 'irreducible', simple reconstructive explanations may be difficult to construct.&amp;nbsp; In this sense, adaptive explanations can also be very far from what actually happened.&amp;nbsp; We can see a net result today, but the evolutionary history of its assembly may be easy to imagine, but&amp;nbsp; difficult to prove or reconstruct.&amp;nbsp; Not food for IntelligentDesigners, but irreducibly complex in retrospect nonetheless.&amp;nbsp; Again, selection works on organisms, no matter how they work.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-5418351571174841255?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/5418351571174841255/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/irreducible-complexitythat-might.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/5418351571174841255'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/5418351571174841255'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/irreducible-complexitythat-might.html' title='Irreducible Complexity....that might actually mean something!'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-mVTrNx6BOGY/TvuK-sMU6xI/AAAAAAAAAHw/qjTILIb2ckU/s72-c/Screen+Shot+2011-12-28+at+4.31.42+PM.png' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-7686585217865102328</id><published>2011-12-28T05:04:00.001-05:00</published><updated>2011-12-28T23:48:29.056-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='sex'/><category scheme='http://www.blogger.com/atom/ns#' term='norms of reaction'/><category scheme='http://www.blogger.com/atom/ns#' term='gender'/><category scheme='http://www.blogger.com/atom/ns#' term='child sexual abuse'/><title type='text'>Mars and Venus: thoughts on the nature and evolution of (sssh!) sex.  Part II</title><content type='html'>We tried to make a delicate &lt;a href="http://ecodevoevo.blogspot.com/2011/11/penn-state-sandusky-scandal-what-is.html"&gt;point&lt;/a&gt;&amp;nbsp;in the wake of the Penn State child abuse scandal, which seems to have&amp;nbsp; 'released' inhibitions across the country, perhaps even more readily than a decade or more of stories about abuse in the Catholic Church.&amp;nbsp; If up to a quarter of people were abused as children, and even if each abuser was a multiple offender, then abusers are very common in our society.&lt;br /&gt;&lt;br /&gt;In the previous post in this series we reviewed an &lt;a href="http://onlinelibrary.wiley.com/doi/10.1002/bies.201100123/abstract"&gt;article&lt;/a&gt; by Barron et al., in the December 2011 &lt;i&gt;BioEssays&lt;/i&gt;, that argued that we now clearly know that there is much more variation in sex-related behavior than a dichotomous male-female view reflects, and that a more nuanced, variation-reflecting truth should be taught in college courses.&amp;nbsp; Plus, of course, if there is so much variation and if it is biologically based, that may call for explanations about how it could have evolved, given the strong and direct fitness effects associated with reproductive success.&lt;br /&gt;&lt;br /&gt;If gender behavior evolved because of Darwinian selection for successful reproduction, a long-standing problem for evolutionary biologists has been to explain the much less common aspects of behavior such as homosexuality, trans-sexuality, voluntary celibacy and the like.&amp;nbsp; Rationales and (we would suggest) post-hoc wriggling have been offered to ensure that gender behavior is indeed biologically driven by a long history of selection 'for' successful reproductive strategies.&lt;br /&gt;&lt;br /&gt;Of course, if there is variation in genes that causes these kinds of anomalies (assuming that they can be called that), one can ask why they exist.&amp;nbsp; The variants must be new enough not yet to have been screened away by selection....yet homosexuality is far too common to have survived such stringent selection.&lt;br /&gt;&lt;br /&gt;Culture can make people do strange things, like be suicide bombers, commit infanticide, or agree to voluntary celibacy.&amp;nbsp; In this sense, culture is a human trait based on imagined truths (going to Heaven for such acts, for example).&amp;nbsp; That means culture can override biological 'imperatives' a view that we would personally agree with.&amp;nbsp; But there's more, since the term imperative invokes just the kind of dichotomous thinking that Barron et al. object to.&lt;br /&gt;&lt;br /&gt;So among other aspects of variation in sex and gender behavior, what could possibly explain anything resembling a &lt;i&gt;quarter &lt;/i&gt;of people being sexually abused and so many abusers?&amp;nbsp;&amp;nbsp; We know that some cultures allow or even mandate consummated marriages for children of ages that in our society would be defined as sexual abuse.&amp;nbsp; This includes cultures that in various ways allow or mandate homosexual encounters with what we define as 'children' (classical Greece is one example, but only one).&amp;nbsp; Definitions of what constitutes rape vary over time, and one can easily list variation that clearly muddies up any simplistic evolutionary arguments:&amp;nbsp; stoning adulterers in societies that now, or recently, have allowed or encouraged polygamy; making forcible sex in marriage illegal and calling it rape; same-sex marriages, and more.&amp;nbsp; And of course there were laws about inter-racial sex or marriage, and there is the current abortion controversy.&lt;br /&gt;&lt;br /&gt;Society can determine what is accepted behavior and who can be locked up for what. &amp;nbsp;Is our idea that child abusers are pathological purely cultural and definitional? Or, why are there so many of them?&amp;nbsp; After all, especially in the case of same-sex abusers, what evolutionary mandate is being reflected in their behavior?&amp;nbsp; Are they super-sexed-up so that during their lives they actually sire more children than their contemporaries--in which case their 'abuse' is simply a manifestation of their superior sexuality? &amp;nbsp;But this seems unlikely since most people are not sexually attracted to children.&lt;br /&gt;&lt;br /&gt;Since our society calls child sexual abuse abnormal and illegal, and in our society, the effect on children can be profound and lifelong, people certainly should not do it!&amp;nbsp; But it seems too common to be called 'abnormal' in the medical or psychopathological sense.&amp;nbsp; The article by Barron et al., if even reasonably on the mark, implies that as a population we have not come to grips with the natural variation in sex-related behavior.&amp;nbsp; Whether the variation is caused by genes (and if even that means it is 'mandated') or by culture, its very existence raises questions that evolutionary psychology should take seriously rather than ignore or sweep under the rug (much less be oblivious to).&lt;br /&gt;&lt;br /&gt;Should how and where social policy and legal constraints ought to be applied be derived from a better understanding of biology, or is it appropriate for cultural and religious criteria to be used to establish constraints, whether or not they go against biological 'mandates' (if there are such things)?&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-7686585217865102328?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/7686585217865102328/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/mars-and-venus-thoughts-on-nature-and_28.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7686585217865102328'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7686585217865102328'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/mars-and-venus-thoughts-on-nature-and_28.html' title='Mars and Venus: thoughts on the nature and evolution of (sssh!) sex.  Part II'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2665906838639523233</id><published>2011-12-27T05:29:00.002-05:00</published><updated>2011-12-28T23:50:45.636-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='plasticity'/><category scheme='http://www.blogger.com/atom/ns#' term='sex'/><category scheme='http://www.blogger.com/atom/ns#' term='norms of reaction'/><category scheme='http://www.blogger.com/atom/ns#' term='nature'/><category scheme='http://www.blogger.com/atom/ns#' term='gender'/><category scheme='http://www.blogger.com/atom/ns#' term='evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='child sexual abuse'/><title type='text'>Mars and Venus: thoughts on the nature and evolution of (sssh!) sex.  Part I</title><content type='html'>In the wake of the revelation of alleged repeated sexual assault on young boys by a big boy who was a football player and legendary coach here at Penn State, we &lt;a href="http://ecodevoevo.blogspot.com/2011/11/penn-state-sandusky-scandal-what-is.html"&gt;mused&lt;/a&gt; about what it all meant.&amp;nbsp; An important part of that story was how the event released all sorts of other allegations of child sexual abuse, by men and women, and figures suggesting that a sixth to as much as a quarter of both men and women had been sexual abused as children.&lt;br /&gt;&lt;br /&gt;That the issue expanded in this way could in part be a common phenomenon of the expansion of definitions to include more than gross physical abuse, copycat claims and the like.&amp;nbsp; But even if that were partly true, still the prevalence of adult offenders is rather astonishing.&amp;nbsp; Sexual abusers are not just very rare deviants, but part of the 'normal' (that is, usual) distribution of sexual behavior--so that child sexual abuse is apparently a common form of violation of law and publicly proclaimed standards.&lt;br /&gt;&lt;br /&gt;This is not any sort of defense of child abuse, and we won't rehash our commentary here.&amp;nbsp; But the point is that there is much more variation in sexual, or perhaps more properly put, gender-related behavior than is generally acknowledged.&lt;br /&gt;&lt;br /&gt;Today's post was triggered by a thoughtful &lt;a href="http://onlinelibrary.wiley.com/doi/10.1002/bies.201100123/abstract"&gt;commentary&lt;/a&gt; by Andrew Barron and two co-authors, in the December issue of &lt;i&gt;BioEssays&lt;/i&gt;, itself a thoughtful journal.&amp;nbsp; The article is about how we are--or aren't--appropriately educating undergraduates about what is actually known about sex and gender and associated behaviors.&amp;nbsp; As the authors put it:&lt;br /&gt;&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Research over the last decades has stimulated a paradigm shift in biology from assuming fixed and dichotomous male and female sexual strategies to an appreciation of significant variation in&amp;nbsp;sex and sexual behaviour both within and between species. This has resulted in the development of a broader biological understanding of sexual strategies, sexuality and variation in sexual behaviour. However, current introductory biological textbooks have not yet incorporated these new research findings.&lt;/blockquote&gt;&lt;br /&gt;The authors further state that&lt;br /&gt;&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Darwin’s strict view of male and female roles most likely reflected the social constraints of his time, yet these stereotypic assumptions have influenced&amp;nbsp; evolutionary and biological research for decades. Darwin characterised males as competitive and eager in the pursuit of females, while females were described as passive, coy and choosy. Darwin’s theory of sexual selection has&amp;nbsp;been enormously influential and still enjoys tremendous research discourse.&lt;/blockquote&gt;&lt;br /&gt;They go on to discuss how we could improve education by properly presenting what is now actually known about sexual behavior, sexual selection, and related topics.&amp;nbsp; Most books cling to the simple ideas of classical Darwinism and their expanded theoretical treatment from a mathematical and selectinonist perspective often called 'evolutionary psychology' or 'behavioral evolution'.&lt;br /&gt;&lt;br /&gt;There is the problem, according to Barron et al., of too rigid a separation of the sexes and much too rigid dichotomization of behavior that, within and among species, is far more variable, plastic, and less stereotypical than is the usual treatment--or caricature--that is offered.&amp;nbsp; Not so long ago, Joan (once Jonathan) Roughgarden wrote a book,&lt;i&gt; Evolution's Rainbow: Diversity, Gender, and Sexuality in Nature and People&lt;/i&gt;, similarly intended to debunk simplistic Darwinian treatments of sexual selection.&amp;nbsp; We mention Joan née Jonathan because Roughgarden can be viewed as having&amp;nbsp; personal, political, and experience-based, as well as scientific interests in a less rigid view of sexual identity and behavior.&amp;nbsp; Points of view are rarely totally disinterested, and that might be expected to be a major aspect of a subject such as this.&lt;br /&gt;&lt;br /&gt;In a somewhat similar vein, Barron et al. argue (and cite supporting literature) that "biological sex (and its associated traits)" are in fact "a fundamentally plastic reaction norm."&amp;nbsp; They cite Kinsey research showing "significant and consistent variation in sexual behavior," and argue that too often sex and gender (sex-related behavior) are equated when they really are far less rigidly stereotypical in humans and in other species.&lt;br /&gt;&lt;br /&gt;To the extent that they are on target, this is a problem because a rigid dichotomization of what is actually more overlapping and variable will lead to social definitions that categorize people, lead to laws setting legal limits and punishments, and restrictions on personal freedoms that are cultural reflections of mistaken biology.&lt;br /&gt;&lt;br /&gt;Someone with strong selectionist views such as are common among evolutionary psychology or behavioral evolution may feel that these authors have overstated the amount variation, and that things are actually more dichotomous than Barron et al. allege or have similar reactions to Roughgarden's book.&amp;nbsp; We are not expert in this area and we are less sanguine about adaptive explanations that are so common and, we feel, weakly supported but too strongly argued in evolutionary psychology.&amp;nbsp; That difference aside, however, the point here is that if one wants to understand sex and gender behavior in our own society (forgetting strutting peacocks and bright red male cardinals), we would do well to understand what is actually going on in Nature, rather than what our culture considers 'right', 'normal', or 'pathological.'&lt;br /&gt;&lt;br /&gt;Barron et al.'s point is that education is doing a disservice to the variation that exists.&amp;nbsp; They identify areas of sex and behavior that they feel should be included in modern college courses on the subject that would properly reflect the variation seen in Nature.&amp;nbsp; Their concern is biological factors (not just cultural ones in humans) that affect sex and gender beyond the mechanics and genetics of reproduction.&amp;nbsp; An example is the controversy over the genetic causation of homosexuality ('gay' genes).&amp;nbsp; They find that psychology texts do a better job of this but that most anthropology and especially biology texts fail their test.&lt;br /&gt;&lt;br /&gt;But what does this have to do with sexual abuse of children?&amp;nbsp; In Part II we'll return to a point we made in our initial Sandusky-related blog-post.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2665906838639523233?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2665906838639523233/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/mars-and-venus-thoughts-on-nature-and.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2665906838639523233'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2665906838639523233'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/mars-and-venus-thoughts-on-nature-and.html' title='Mars and Venus: thoughts on the nature and evolution of (sssh!) sex.  Part I'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-4047698116256840704</id><published>2011-12-24T16:04:00.000-05:00</published><updated>2011-12-24T16:04:31.845-05:00</updated><title type='text'>I'd rather be a Pagan suckled in a creed outworn</title><content type='html'>We've been posting some poetry appropriate to the season. &amp;nbsp;A friend sent this famous Wordsworth poem, appropriate to a season in which materialism can overtake other attitudes about the world. &amp;nbsp;The ideas are relevant even to those not formally celebrating these days for religious reasons. &amp;nbsp;At least, their spirit is about perceiving the nature of the Nature of which we're apart, and in cultural terms, about trying to get along and live together. &amp;nbsp;Maybe you recall this from your school days, as we did. &amp;nbsp;But we thank Hank for reminding us of it.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span class="Apple-style-span" style="border-collapse: collapse; color: #222222; font-family: arial, sans-serif; font-size: 13px;"&gt;&lt;span style="border-collapse: collapse; color: #500050; font-family: arial, sans-serif; font-size: 13px;"&gt;"THE WORLD IS TOO MUCH WITH US; LATE AND SOON"&lt;br /&gt;&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; THE world is too much with us; late and soon,&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Getting and spending, we lay waste our powers:&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Little we see in Nature that is ours;&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; We have given our hearts away, a sordid boon!&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; The Sea that bares her bosom to the moon;&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; The winds that will be howling at all hours,&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; And are up-gathered now like sleeping flowers;&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; For this, for everything, we are out of tune;&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; It moves us not.--Great God! I'd rather be&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; A Pagan suckled in a creed outworn; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; So might I, standing on this pleasant lea,&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Have glimpses that would make me less forlorn;&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Have sight of Proteus rising from the sea;&lt;br /&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Or hear old Triton blow his wreathed horn.&lt;/span&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="border-collapse: collapse; color: #222222; font-family: arial, sans-serif; font-size: 13px;"&gt;&lt;span style="border-collapse: collapse; color: #500050; font-family: arial, sans-serif; font-size: 13px;"&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; 1806.&lt;/span&gt;&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-4047698116256840704?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/4047698116256840704/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/weve-been-posting-some-poetry.html#comment-form' title='4 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4047698116256840704'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4047698116256840704'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/weve-been-posting-some-poetry.html' title='I&apos;d rather be a Pagan suckled in a creed outworn'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>4</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-4228279660066078198</id><published>2011-12-23T08:49:00.001-05:00</published><updated>2011-12-23T09:01:05.913-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Holiday greetings'/><title type='text'>No need for tribalism: just good holiday wishes!</title><content type='html'>We've been discussing (debating? arguing?) atheism vs organized religion, and whether there can even &lt;i&gt;be&lt;/i&gt; actual discussion.&amp;nbsp; But, back from the brink, we also posted a couple of nice verses about the season, and nice behavior was one of the issues around which the post that elicited the atheism/religion debate was motivated.&lt;br /&gt;&lt;br /&gt;An important point is that one can have holiday wishes, and spread them around, without their being tied to any dogma.&amp;nbsp; Here, in a well-known verse by the often beautifully pastoral poet William Wadsworth, is an example of good holiday cheer:&lt;br /&gt;&lt;br /&gt;&lt;span style="font-size: large;"&gt;&lt;b&gt;The Minstrels&lt;/b&gt;&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: arial, helvetica, swiss;"&gt;The minstrels played their Christmas** tune &lt;br /&gt;To-night beneath my cottage-eaves; &lt;br /&gt;While, smitten by a lofty moon, &lt;br /&gt;The encircling laurels, thick with leaves, &lt;br /&gt;Gave back a rich and dazzling sheen, &lt;br /&gt;That overpowered their natural green. &lt;br /&gt;&lt;br /&gt;Through hill and valley every breeze &lt;br /&gt;Had sunk to rest with folded wings: &lt;br /&gt;Keen was the air, but could not freeze, &lt;br /&gt;Nor check, the music of the strings; &lt;br /&gt;So stout and hardy were the band &lt;br /&gt;That scraped the chords with strenuous hand. &lt;br /&gt;&lt;br /&gt;And who but listened?—till was paid &lt;br /&gt;Respect to every inmate’s claim, &lt;br /&gt;The greeting given, the music played &lt;br /&gt;In honour of each household name, &lt;br /&gt;Duly pronounced with lusty call, &lt;br /&gt;And “Merry Christmas” wished to all.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-family: arial, helvetica, swiss;"&gt;**or however you wish to refer to the season's rationale  &lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-4228279660066078198?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/4228279660066078198/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/no-need-for-tribalism-just-good-holiday.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4228279660066078198'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4228279660066078198'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/no-need-for-tribalism-just-good-holiday.html' title='No need for tribalism: just good holiday wishes!'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-8774517146543596464</id><published>2011-12-23T05:00:00.004-05:00</published><updated>2011-12-23T05:00:05.936-05:00</updated><title type='text'>Poems for winter</title><content type='html'>Two days ago on the Solstice we received an email from a long-time MT reader, who lives in&amp;nbsp;Minnesota. &amp;nbsp;He wrote that there was no snow on the Solstice there for the first time in five years, and that the colors are muted, and will be for the duration. &amp;nbsp;Though, as he said, some birds, the chickadees and juncos "appear to dress for dining." &amp;nbsp;His message was&amp;nbsp;lovely, a bow to the day, and a welcome reminder that we aren't just talking to ourselves. &amp;nbsp;He included two poems, sent to him in turn by a friend to mark the day. &amp;nbsp;The Solstice is past, but here in the northern hemisphere we won't notice the lengthening of the days for some weeks to come, and these poems aren't specifically dedicated to the shortest day of the year so we thought we'd share them with you. &lt;br /&gt;&lt;br /&gt;....And if you have some timely or thoughtful verse to add in Comments or to send to us, we'd like that. &lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;&lt;b&gt;Black Rook in Rainy Weather&lt;/b&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;On the stiff twig up there&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Hunches a wet black rook&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Arranging and rearranging its feathers in the rain.&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;I do not expect a miracle&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Or an accident&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;To set the sight on fire&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;In my eye, nor seek&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Any more in the desultory weather some design,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;But let spotted leaves fall as they fall,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Without ceremony, or portent.&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Although, I admit, I desire,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Occasionally, some backtalk&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;From the mute sky, I can't honestly complain:&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;A certain minor light may still&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Lean incandescent&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Out of kitchen table or chair&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;As if a celestial burning took&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Possession of the most obtuse objects now and then --&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Thus hallowing an interval&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Otherwise inconsequent&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;By bestowing largesse, honor,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;One might say love. At any rate, I now walk&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Wary (for it could happen&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Even in this dull, ruinous landscape); skeptical,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Yet politic; ignorant&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Of whatever angel may choose to flare&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Suddenly at my elbow. I only know that a rook&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Ordering its black feathers can so shine&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;As to seize my senses, haul&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;My eyelids up, and grant&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;A brief respite from fear&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Of total neutrality. With luck,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Trekking stubborn through this season&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Of fatigue, I shall&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Patch together a content&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Of sorts. Miracles occur,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;If you care to call those spasmodic&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;Tricks of radiance miracles. The wait's begun again,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;The long wait for the angel,&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;For that rare, random descent.&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: Georgia, serif; font-size: 15px;"&gt;&amp;nbsp;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;&amp;nbsp;&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: Georgia, serif; font-size: 15px;"&gt;--by Sylvia Plath&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia, serif; font-size: 15px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px; margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;span class="Apple-style-span" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;&lt;div class="MsoNormal" style="margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span class="Apple-style-span" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;&lt;span style="font-family: Georgia, serif;"&gt;&lt;span style="font-size: small;"&gt;&lt;b&gt;I HAVE NEWS&lt;/b&gt;&lt;/span&gt;&lt;/span&gt;&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span class="Apple-style-span" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span class="Apple-style-span" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;&lt;span style="font-family: Georgia, serif;"&gt;&lt;span style="font-size: small;"&gt;I have news for you:&lt;br /&gt;The stag bells, winter snows,&lt;br /&gt;Summer has gone&lt;br /&gt;Wind high and cold,&lt;br /&gt;The sun low, short its course&lt;br /&gt;The sea running high.&lt;br /&gt;Deep red the bracken;&lt;br /&gt;Its shape is lost;&lt;br /&gt;The wild goose has raised its accustomed cry,&lt;br /&gt;Cold has seized the birds' wings;&lt;br /&gt;Season of ice, this is my news&lt;u&gt;&lt;/u&gt;&lt;u&gt;&lt;/u&gt;&lt;/span&gt;&lt;/span&gt;&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="margin-bottom: 0pt; margin-left: 0in; margin-right: 0in; margin-top: 0in;"&gt;&lt;span class="Apple-style-span" style="border-collapse: collapse; color: #222222; font-family: 'Segoe UI'; font-size: 13px;"&gt;&lt;span style="font-family: Georgia, serif; font-size: 11pt;"&gt;&lt;span style="font-family: Georgia, serif;"&gt;&lt;span style="font-size: small;"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;--9th C. Irish&lt;/span&gt;&lt;/span&gt;&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-8774517146543596464?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/8774517146543596464/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/poems-for-winter.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8774517146543596464'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/8774517146543596464'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/poems-for-winter.html' title='Poems for winter'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-4926483807910290782</id><published>2011-12-22T08:14:00.000-05:00</published><updated>2011-12-22T08:26:02.945-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Christopher Hitchins'/><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='Atheism'/><category scheme='http://www.blogger.com/atom/ns#' term='science'/><title type='text'>Hitchins your wagon to a star</title><content type='html'>A lot has been made of the death of the professional curmudgeon Christopher Hitchins.&amp;nbsp; He was one of the recent spate of public intellectuals who are also strident atheists.&amp;nbsp; For some reason, the public idolizes these guys as if they were rock or sports stars.&amp;nbsp; If it were all about entertainment, then one could respond according to his/her views about how much of that such stars deserve in any society with measured values.&amp;nbsp; Perhaps they bring pleasure, and that's worth more than so much else&amp;nbsp; in life that is rewarded less plentifully.&lt;br /&gt;&lt;br /&gt;The strident atheists get ink and airtime because they are glib and claim that science proves their atheism, and they make a 'story' by using hyperbole to ridicule believers in standard religions.&amp;nbsp; Among other arguments, they point out how much damage has been done in the name of such religions, though perhaps without realizing the similar nature of their relentless anti-religion.&amp;nbsp; I have been reading Vasily Grossman's &lt;i&gt;Life and Fate&lt;/i&gt;, his classic WWII Russian-novel that's an analog of Tolstoy's&amp;nbsp; &lt;i&gt;War and Peace&lt;/i&gt;.&amp;nbsp; Tolstoy was a communist of sorts, in the best share-the-wealth sense of the term, but his book was more about the rather mechanical forces that control human history than the Great Men to whom historians typically give all the credit.&lt;br /&gt;&lt;br /&gt;Grossman's book is about the mechanical grind of evil and human cruelty, often perpetrated in the name of ideology, be it organized religion or its analogs in atheistic communism or fascism (or, we'd add, in sciences like Darwinian-based eugenics).&amp;nbsp; In a very angry and poignant chapter that I wish I could download and post to MT readers copyright free, Grossman argues that as soon as organized religion gains power it almost inevitably brings on evil, in the form of 'We are better than you!' which leads to 'We have to kill you in the name of Truth or Goodness!'&amp;nbsp; Secular ideologies, like Grossman's communist Soviet state, do exactly the same thing as Christianity and other major religions.&lt;br /&gt;&lt;br /&gt;Grossman argues that goodness exists only when it has no power, in the lone or even anonymous individual acts of kindness, sometimes under the most horrendous of circumstances.&amp;nbsp; It's person to person, not organized and not implemented by states or churches.&amp;nbsp; It works because it has &lt;i&gt;no&lt;/i&gt; power except kindness on its own, for its own sake, in the name of nothing higher or more grand than just a quiet helping hand.&amp;nbsp; Grossman has a point.&lt;br /&gt;&lt;br /&gt;&lt;a href="http://4.bp.blogspot.com/-SRY4LrVyGz8/TvJ7Gh8ZX0I/AAAAAAAACNE/L8Tmee3szMA/s1600/399px-Leonid_Meteor.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="320" src="http://4.bp.blogspot.com/-SRY4LrVyGz8/TvJ7Gh8ZX0I/AAAAAAAACNE/L8Tmee3szMA/s320/399px-Leonid_Meteor.jpg" width="213" /&gt;&lt;/a&gt;People&amp;nbsp; want certainty and to gang together with others who share the same certainty.&amp;nbsp; Scientists are no different in this respect (and, to the extent we develop weapons or create discriminatory ideologies, no better, either).&amp;nbsp; We want simple answers,&amp;nbsp; not complexity, even if complexity is Nature's reality.&amp;nbsp; The strident atheists reflect this:&amp;nbsp; in their own simplistic way they are surely right in pointing out the evils perpetrated in the name of theological religion, and the utter lack of any actual evidence for the organized theological belief systems.&amp;nbsp; It's hard to argue coherently with that, as Hitchins' debate opponents found out.&amp;nbsp; But the lack of evidence for religious truths doesn't mean that science can &lt;i&gt;disprove&lt;/i&gt; religious assertions, nor certainly that they have any moral high ground from which to give &lt;i&gt;their &lt;/i&gt;sermons.&lt;br /&gt;&lt;br /&gt;The most scientists can do is to point out the rather empirically absurd aspects of so many beliefs. Given the vast coldness of the universe, our puny protoplasmic nature, and the mortal or worse evils perpetrated by those claiming to believe in versions of the Good, it is simply very difficult to be a serious scientist and hold to religions based on personal, loving Gods who care about our daily burps.&amp;nbsp; Or to think that there is any rational reason to believe that a system would be set up for us to suffer here for decades (or less) and then be transported forever to some wonderful peaceful place.&amp;nbsp; Nor how this Goodness could deliver a multiple whammy such as has just befallen some friends of ours, good people not deserving of such hits (Thanks, God, and Merry Christmas to you, too!). &lt;br /&gt;&lt;br /&gt;It makes no actual sense but worse, tragically, too many believers have been, and are, willing to commit horrors on others in the name of their Goodness, whatever its particular brand, and not withstanding the actual good that many of the same people and organizations do.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;The world holds together logically with the kinds of explanations that science offers, no matter that we have gaps in our understanding.&amp;nbsp; It's frightening and depressing, perhaps, to think that science has shown us the nature of our frigid landscape.&amp;nbsp; But the coldness of harsh realities need not lead either to illusions or to harshness on our part.&lt;br /&gt;&lt;br /&gt;Can we do better?&amp;nbsp; Can we hitch our wagons to some better star, of actual rather than imagined knowledge? &amp;nbsp;The star will take us so far, but no farther, than what human knowledge can deliver.&amp;nbsp; But we can accept the harshness of life and death, without using that to &lt;i&gt;justify &lt;/i&gt;harshness or cruelty.&amp;nbsp; We know clearly, as we've tried to argue here on MT and in our book of the same name, that cooperation is pervasive in all&amp;nbsp; aspects of life, much moreso than competition.&lt;br /&gt;&lt;br /&gt;We can take a different path, and argue that if all we have is here and now, and we're in it together, we should&amp;nbsp; share a wagon hitched to a brighter star than what's offered by strident atheists.&amp;nbsp; We may not be able to find scientific justification for such kinder behavior, but we need not search for it in the stars but in our own, individual, local instincts and feelings.&lt;br /&gt;&lt;br /&gt;Even in a Darwinian world, the existence, after so many evolutionary millennia, of sparks of local kindness show that it is possible to act cooperatively rather than competitively, warmly rather than coldly.&amp;nbsp; If we can do this on a local level, why not on a more organized level as well?&amp;nbsp; Is that impossible, or is it just that, in societies usually organized around ideology, we haven't learned to do it yet? &lt;br /&gt;&lt;br /&gt;We should be able to do this a-theistically, that is, without having to justify it by invoking a God or received sacred book as a justification--even if somehow they could be true.&amp;nbsp; But this is not the same as justifying any behavior on the grounds of the &lt;i&gt;lack&lt;/i&gt; of evidence for such received truths, or on a belief instructed by atheism (or any other 'ism').&amp;nbsp; It is part of our individual nature, whether or not it can ever be at the core of our collective nature.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-4926483807910290782?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/4926483807910290782/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/hitchins-your-wagon-to-star.html#comment-form' title='17 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4926483807910290782'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4926483807910290782'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/hitchins-your-wagon-to-star.html' title='Hitchins your wagon to a star'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/-SRY4LrVyGz8/TvJ7Gh8ZX0I/AAAAAAAACNE/L8Tmee3szMA/s72-c/399px-Leonid_Meteor.jpg' height='72' width='72'/><thr:total>17</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2423811776721507978</id><published>2011-12-21T05:31:00.011-05:00</published><updated>2011-12-21T08:17:52.044-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='genetics'/><category scheme='http://www.blogger.com/atom/ns#' term='virus'/><category scheme='http://www.blogger.com/atom/ns#' term='technology'/><category scheme='http://www.blogger.com/atom/ns#' term='antiviral agent'/><title type='text'>Good crud -- antivirals</title><content type='html'>&lt;a href="http://2.bp.blogspot.com/-R-nHBGTFkZI/TvDvWIzWR5I/AAAAAAAACM4/UsDPo9riOi0/s1600/2527virus-cells-creativity103-cc.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="200" src="http://2.bp.blogspot.com/-R-nHBGTFkZI/TvDvWIzWR5I/AAAAAAAACM4/UsDPo9riOi0/s200/2527virus-cells-creativity103-cc.jpg" width="150" /&gt;&lt;/a&gt;The development of antiviral agents to combat viral infections from the common cold to HIV, hepatitis, SARS, Ebola, and other lethal diseases has proven to be elusive to date. &amp;nbsp;Such an agent would be an invaluable contribution to the world's armamentarium against disease. &amp;nbsp;And now it may be that the world is on the verge of getting such an agent. &amp;nbsp;Last year, Leo James, an immunologist at Cambridge reported in &lt;i&gt;&lt;a href="http://www.pnas.org/content/early/2010/11/01/1014074107"&gt;PNAS&lt;/a&gt;&lt;/i&gt; that his lab had found that antibodies can make their way into cells and destroy the virus before it harms the cell or causes illness. &amp;nbsp;This was treated as great news for the possible development of antivirals, though it was early days, and of course much more work is needed.&lt;br /&gt;&lt;br /&gt;Then, Todd Rider, at MIT, published a &lt;a href="http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0022572"&gt;paper&lt;/a&gt;&amp;nbsp;in &lt;i&gt;PLoS One&lt;/i&gt; in July that reported progress on a treatment that takes advantage of the double stranded nature of RNA viruses, and the ability of cells to kill themselves when they detect that they've been infected by a virus. &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;We have developed a new broad-spectrum&amp;nbsp;&lt;/span&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;antiviral approach,&amp;nbsp;&lt;/span&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: Times, 'Times New Roman', serif;"&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;dubbed&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&amp;nbsp;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&lt;u&gt;D&lt;/u&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;ouble-stranded&amp;nbsp;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&lt;u&gt;R&lt;/u&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;NA (dsRNA)&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&amp;nbsp;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&lt;u&gt;A&lt;/u&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;ctivated&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&amp;nbsp;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&lt;u&gt;C&lt;/u&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;aspase&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;&lt;u&gt;O&lt;/u&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="color: #303030; line-height: 21px;"&gt;ligomerizer (DRACO) that selectively induces apoptosis in cells containing viral dsRNA, rapidly killing infected cells without harming uninfected cells. We have created DRACOs and shown that they are nontoxic in 11 mammalian cell types and effective against 15 different viruses, including dengue flavivirus, Amapari and Tacaribe arenaviruses, Guama bunyavirus, and H1N1 influenza. We have also demonstrated that DRACOs can rescue mice challenged with H1N1 influenza. DRACOs have the potential to be effective therapeutics or prophylactics for numerous clinical and priority viruses, due to the broad-spectrum sensitivity of the dsRNA detection domain, the potent activity of the apoptosis induction domain, and the novel direct linkage between the two which viruses have never encountered.&lt;/span&gt;&lt;/span&gt;&lt;/blockquote&gt;Why this was published in PLoS One, which is in many senses not really a fully peer reviewed journal, if it is so important isn't clear. &amp;nbsp;Maybe it was rejected by more noted journals, or maybe the authors believe in the public library concept, or they want quick publication without the usual delays and hassles with nit-picking referees. &amp;nbsp;In any case, why is the BBC just getting around to &lt;a href="http://www.bbc.co.uk/news/magazine-16165605"&gt;reporting&lt;/a&gt; this now? &amp;nbsp;Because they've just done a &lt;a href="http://www.bbc.co.uk/iplayer/episode/p00m1c6l/Discovery_Antivirals/"&gt;radio segment&lt;/a&gt; on the development of antivirals, including an interview with Rider, highlighting his work. &lt;br /&gt;&lt;br /&gt;Viruses are difficult to stop because they are complete parasites, and so much of how they work is identical to how our own cells work. &amp;nbsp;Bacteria are easier targets because they are so different from ourselves, and so destroying them doesn't pose the same kind of risk to our own cells that targeting viruses does.&lt;br /&gt;&lt;br /&gt;A number of labs are currently working on antivirals, from somewhat different angles.&amp;nbsp;Peter Palese at Mt Sinai has found a compound which is active at least against influenza, and perhaps other respiratory viruses, though in principle, the list could be longer. &amp;nbsp;Every cell needs pyrimidines to make nucleic acids -- if you reduce the pool of pyrimidines, viruses won't be able to replicate. &amp;nbsp;Palese has identified a compound that acts to reduce that pool, which results in a lower viral load and absence of clinical disease, at least for the flu.&amp;nbsp; Why that wouldn't harm the host cells for the same reason isn't clear (to us, who aren't experts in this area by any means).&lt;br /&gt;&lt;br /&gt;A different agent looks to be effective against a large number of viruses. &amp;nbsp;Benhur Lee at UCLA has identified a compound that seemed to be effective against poxes, RNA viruses, DNA viruses, and many others. &amp;nbsp;These are lipid envelope viruses; Lee's agent attacks the viral lipid membrane, disarming at least (or only, it's not yet clear) this type of virus. &lt;br /&gt;&lt;br /&gt;But Todd Rider suggests that his drug, or DRACO (yes, you are supposed to think of "draconian") will be able to treat all viral infections, without harming uninfected cells. &amp;nbsp;Cells have enzymes that can detect long dsRNA -- when they detect it, they fight the virus off. &amp;nbsp;But, some viruses can outsmart that system, so Rider has wired together the protein that recognizes dsRNA with a caspase, a protein that triggers apoptosis, or cell suicide. &amp;nbsp;When it finds the dsRNA, it will activate the caspase, causing the infected cell to destroy itself.&lt;br /&gt;&lt;br /&gt;Will this method become clinically useful? &amp;nbsp;Other immunologists caution that success in the laboratory is a far cry from success in infected humans. &amp;nbsp;Rider recognizes that he has a lot more work to do, but he says that so far no one has offered a reason why his antiviral approach isn't going to work. &amp;nbsp;The potential seems to be there. &amp;nbsp;Of course, side effects, both foreseen and unforeseen, are a potential risk, as with any new way we find to mess with biology, but this all sounds like progress on an important scale. &lt;br /&gt;&lt;br /&gt;If one or more antiviral agent is on the horizon, it is in part due to increased understanding of viruses at the genetic level. &amp;nbsp;This we would say is a laudable use of genetic knowledge and technology. &amp;nbsp;It may be that 90% of the work will turn out to be crud, but this is the kind of generation of crud that seems to us to be justified.&amp;nbsp; And the ubiquity and importance to humans and our pets and food sources, of better control of viruses means this kind of work could be as important as most of us (vainly) claim their (our) work to be.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2423811776721507978?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2423811776721507978/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/good-crud-antivirals.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2423811776721507978'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2423811776721507978'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/good-crud-antivirals.html' title='Good crud -- antivirals'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-R-nHBGTFkZI/TvDvWIzWR5I/AAAAAAAACM4/UsDPo9riOi0/s72-c/2527virus-cells-creativity103-cc.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-7885264715807944625</id><published>2011-12-20T05:54:00.016-05:00</published><updated>2011-12-20T05:54:00.068-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='epidemiology'/><category scheme='http://www.blogger.com/atom/ns#' term='public health'/><category scheme='http://www.blogger.com/atom/ns#' term='malaria'/><category scheme='http://www.blogger.com/atom/ns#' term='WHO'/><title type='text'>Good news on malaria.  Kind of.</title><content type='html'>&lt;a href="http://2.bp.blogspot.com/-mmQDh7t9Ouo/Tu-B7G0NR7I/AAAAAAAACMw/fQLTHb485p4/s1600/mosquito_feeding.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="128" src="http://2.bp.blogspot.com/-mmQDh7t9Ouo/Tu-B7G0NR7I/AAAAAAAACMw/fQLTHb485p4/s200/mosquito_feeding.jpg" width="200" /&gt;&lt;/a&gt;It has been said that malaria has killed&amp;nbsp; more people than any other single cause in human history.&amp;nbsp; And that's not to mention the problem of ill health in people even if they don't die.&amp;nbsp; The reason for its toll seems to be the association of malaria with agriculture and settled populations that provide the right ecology for the disease.&amp;nbsp; Those populations were far larger than their ancestors', making vastly more people vulnerable than had ever lived in the past.&amp;nbsp; The evolution of genetic resistance has helped save many people, but not all that effectively.&lt;br /&gt;&lt;br /&gt;But there's some good news from the World Health Organization.&amp;nbsp; The &lt;a href="http://www.who.int/malaria/world_malaria_report_2010/worldmalariareport2010.pdf"&gt;2010 World Malaria Report&lt;/a&gt; states that the number of people who died from the disease has fallen 26 percent since 2000, 5 percent since 2009, to on the order of 655,000 deaths last year, predominantly children under the age of five.&amp;nbsp; And 2010 was the first year when no locally contracted cases of malaria were reported in the European region.&amp;nbsp; The WHO says this is because of increased use of malarial control measures such as the use of insecticide-treated mosquito nets, the increased availability of effective medicines, and the rise in the proportion of cases confirmed by testing prior to treatment, a widespread effort to reduce the spread of treatment-resistant disease.&lt;br /&gt;&lt;br /&gt;However, WHO had previously set the goal of reducing incidence by half by 2010 from the rate in 2000, but it fell by only an estimated 17 percent (figures were not believed to be accurate enough from two dozen countries in Africa to be more precise about the rates).&amp;nbsp; The WHO has also set the goal of reducing mortality to almost none by 2015, a goal that is probably unlikely to be met, in spite of the fact that bed nets and diagnostic tests are cheap.&lt;br /&gt;&lt;br /&gt;A &lt;a href="http://www.statesmanjournal.com/article/20111218/NEWS/112180323/New-goal-set-fight-against-malaria"&gt;story &lt;/a&gt;at StatesmanJournal.com questions the wisdom of setting such grandiose goals. &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Dr. Robert Newman, director of WHO's malaria program, said it is  disappointing not to have reduced malaria by 50 percent by last year.  But, he said, it was "truly significant progress" that the parasitic  disease's death rates fell by more than one-third in Africa.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;He  described the current goal of cutting malaria deaths to "near zero" by  the end of 2015 as "aspirational," but added that it wouldn't be  accomplished unless every person at risk has access to a bed net and  suspected cases are properly diagnosed and treated. Newman also said it  would cost $6 billion a year — about three times more than the world  currently spends — to be successful.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;"It is unacceptable that  people continue to die from malaria for lack of a $5 bed net, a 50 cent  diagnostic test and a $1 anti-malarial treatment," Newman said in an  email.&lt;/blockquote&gt;The risk is that because control is so dependent on continuing donations from both the public and private spheres, when goals aren't attained, donors may stop giving.&amp;nbsp; This is the history of disease control.&amp;nbsp; And the global financial crisis isn't helping.&amp;nbsp; In fact, the Global Fund to Fight AIDS, Tuberculosis and Malaria, the primary funding agency for public health programs, currently can't fund its next round of grants.&amp;nbsp; Their financial difficulties will mean less funding for bed nets and treatment programs.&amp;nbsp; So, the danger of improved control becoming elusive is real. Yet bureaucracies, in our current 'advertising age' seem unable to keep their fund-seeking hype, in the form of these unrealistic goals, under control--and/or our population has come to be responsive only to hype.&amp;nbsp; Either way, it's not a good way to be!&lt;br /&gt;&lt;br /&gt;We are also interested that the WHO report doesn't mention the reduction in malaria incidence that can't be explained by bed nets or treatment, something we &lt;a href="http://ecodevoevo.blogspot.com/2011/09/killing-malaria.html"&gt;blogged &lt;/a&gt;about back in September. We cited a&amp;nbsp;&lt;a href="http://www.malariajournal.com/content/pdf/1475-2875-10-188.pdf"&gt;paper &lt;/a&gt;published in the September issue of &lt;i&gt;Malaria Journal &lt;/i&gt;by Meyrowitsch et al. which suggested:&lt;br /&gt;&lt;blockquote&gt;...other factors not related to intervention could  potentially have an impact on mosquito vectors, and thereby  reduce  transmission, which subsequently will result in reductions in  number of  infected cases. Among these factors are urbanization, changes  in  agricultural practices and land use, and economic development  resulting  in e.g. improved housing construction.&lt;/blockquote&gt;Or, they suggested, the decline  might also be attributable to a decrease in the  mosquito population due  to changing rainfall patterns caused by climate  change, an hypothesis  tested by Meyrowitsch et al.&amp;nbsp; Year-to-year climate changes are going to be unpredictable, which means that their effect on mosquito populations, and thus malaria incidence and mortality, will be unpredictable as well.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;It's probably a mistake for an organization like the WHO to set unattainable goals, but it's also a mistake for them to let it seem as though they understand all the forces responsible for the epidemiology of a disease like malaria, which depends on a complex interplay of climatic, demographic, social, economic and biological factors, and is thus much more difficult to explain and predict than by simply reducing it to bed nets and treatment.&amp;nbsp; And comparably more problematic to predict rates of success or its timing.&amp;nbsp; Bed netting and treatment are crucial, of course, but its a disservice to the public health infrastructure that is working hard to control the disease to make it seem simple. &lt;br /&gt;&lt;br /&gt;But, on a positive note, at least no one's saying that if only we could sequence, or even genotype, everyone at risk we'd have the problem licked.&amp;nbsp; Maybe if we sequenced a few mosquito nets though....&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-7885264715807944625?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/7885264715807944625/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/good-news-on-malaria-kind-of.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7885264715807944625'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7885264715807944625'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/good-news-on-malaria-kind-of.html' title='Good news on malaria.  Kind of.'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-mmQDh7t9Ouo/Tu-B7G0NR7I/AAAAAAAACMw/fQLTHb485p4/s72-c/mosquito_feeding.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2598607499206655945</id><published>2011-12-19T05:30:00.063-05:00</published><updated>2011-12-19T05:30:06.242-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='biomedical research'/><category scheme='http://www.blogger.com/atom/ns#' term='chimpanzees'/><category scheme='http://www.blogger.com/atom/ns#' term='Institute of Medicine report'/><title type='text'>Chimps looking back at us</title><content type='html'>Chimpanzees are our closest genetic relatives, and as such have long been used in medical research, particularly in the kinds of experiments that have been deemed unethical to perform on humans. &amp;nbsp;They've been used to test vaccines and drugs and new medical procedures, and in psychological and behavioral experiments, and so forth. &amp;nbsp;Now, in recognition of the similarity chimps have to ourselves, the Institute of Medicine of the National Academies in the US is saying that&amp;nbsp;the continued use of our nearest brethren in experimentation is immoral and unethical, and they are recommending&amp;nbsp;that their use be drastically curtailed. &amp;nbsp;According to the CNN &lt;a href="http://thechart.blogs.cnn.com/2011/12/15/restricted-use-of-chimps-in-government-research-recommended/?hpt=hp_t2"&gt;story&lt;/a&gt;&amp;nbsp;reporting this:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;The IOM recommends that chimps should be used only if the research project cannot be ethically performed on people and that the use of these primates should be allowed only if their use will prevent humans from being treated to a life threatening or debilitating condition. &amp;nbsp;According to the IOM, aced on these criteria, chimpanzees are not necessary for most biomedical research. &amp;nbsp;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;The IOM also stated that NIH should also limit the use of chimps in behavioral research in studies that provide very few insights into normal and abnormal behavior, mental and emotional health or cognitive skills. &amp;nbsp;And if the chimps are used in these experiments, NIH should use techniques that do little harm to the animal both physically and mentally.&amp;nbsp;&lt;/blockquote&gt;The &lt;a href="http://iom.edu/Reports/2011/Chimpanzees-in-Biomedical-and-Behavioral-Research-Assessing-the-Necessity.aspx"&gt;report&lt;/a&gt; itself lists these criteria for deciding when their use is deemed moral and appropriate.&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-BFa83C2UFdE/Tu5AYIgAczI/AAAAAAAACMo/eGuo6eq2x40/s1600/chimpanzee_criteria_sized.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="252" src="http://2.bp.blogspot.com/-BFa83C2UFdE/Tu5AYIgAczI/AAAAAAAACMo/eGuo6eq2x40/s400/chimpanzee_criteria_sized.jpg" width="400" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;The NIH has long banned killing chimps when their usefulness is over, unless they are suffering. &amp;nbsp;For that reason a number of chimpanzee retirement centers have been established, where chimps are only sent out to pasture metaphorically. &amp;nbsp;They've got tv's, play areas, all the food they can eat, good medical care, and companionship. &amp;nbsp;What more could they ask? &amp;nbsp;Except maybe a good jungle?&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;Even the latter is provided, after a fashion, by one such place, Chimp Haven, in Louisiana.&amp;nbsp; There chimpanzees retired from research are given a decent environment in which to live out their natural lives, as described on their &lt;a href="ttp://www.chimphaven.org/"&gt;web site&lt;/a&gt;:&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;/div&gt;&lt;blockquote class="tr_bq"&gt;Chimp Haven’s construction began in May 2003 on 200 acres of pristine  forest, donated by the local citizens of Caddo Parish, Louisiana. Chimp  Haven’s facility includes an interconnected network of bedrooms, outdoor  courtyard and play yards, and large, forested habitats up to five  acres. &lt;/blockquote&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-T3aDf5UtSBU/Tu5KwhhJvCI/AAAAAAAAAHQ/Mye4eD1pfwg/s1600/AerialviewChimpHaven2004_RD.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="216" src="http://2.bp.blogspot.com/-T3aDf5UtSBU/Tu5KwhhJvCI/AAAAAAAAAHQ/Mye4eD1pfwg/s320/AerialviewChimpHaven2004_RD.jpg" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://3.bp.blogspot.com/-HFNO2wockoY/Tu5KypL3wLI/AAAAAAAAAHY/l2xxkqTOhXw/s1600/DSCN1739-300x225.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" src="http://3.bp.blogspot.com/-HFNO2wockoY/Tu5KypL3wLI/AAAAAAAAAHY/l2xxkqTOhXw/s1600/DSCN1739-300x225.jpg" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;We applaud these new regulations. &amp;nbsp;As regular readers know, we have often commented on examples of less than useful research being done. &amp;nbsp;Clinical trials aren't our area, so we can't speak to whether drug testing on chimps is valuable overall, but since a large number of experiments done with humans are let's say inconclusive this must be true for chimps as well, particularly in the psychological or behavioral realm.&amp;nbsp; It has been said, indeed, that the psychological world of chimps is so different from ours that decades of research on chimps' ability to learn 'language'--meaning human language'--have been a misguided waste of research resources, despite the human interest of the results (that is, that most research along such lines, despite protests of the investigators of course, would fall into the NIH prohibited category).&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;There is of course the question of the arbitrariness by which we decide what species we can do what to in the lab.&amp;nbsp; Why just chimpanzees or other great apes? Why not baboons, who are widely used by researchers (including ourselves, though we only look at ones that died naturally and are interested in morphology rather than physiology or behavior)?&amp;nbsp; What about the long-used (or abused?) rhesus monkeys?&amp;nbsp; Do they not have a cognitive world in which fear and suffering are included?&amp;nbsp; If they are so different from us as to be unqualified for special protection, why do we study them?&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;The question can be, and perhaps should be, extended to all vertebrates, or perhaps all animals.&amp;nbsp; No one can seriously deny that fish or even insects manifest the signs of fear, though that seems to be the position on which university research review boards act.&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;There is the interesting case of Neandertals, too, now that their DNA has been sequenced after a fashion (the 'whole genome' sequence available so far is not really the whole genome and it's from a composite of different individual fossils, as far as we are aware).&amp;nbsp; There has been some salivation over the juicy possibility of &lt;i&gt;cloning&lt;/i&gt; a Neandertal, in the sense of replace all the 'genes' (protein coding regions) in a human by those sequenced in Neandertals, and then using that for in vitro fertilization in some donor-incubator (a human?&amp;nbsp; a chimp?).&amp;nbsp; Would this be cruelty to the gestator?&amp;nbsp; And what about the 'Neandertal' thus produced?&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;Neandertals are, consistent with the fossil record and their genomes, very close to humans in genome structure (90% closer than chimps, relatively speaking).&amp;nbsp; Essentially, they &lt;i&gt;were &lt;/i&gt;human, and debates about whether they could interbreed with those contemporaries who, based on fossils, seem more directly in our line of ancestors, are rather silly.&amp;nbsp; Indeed, the evidence suggests interbreeding, so that they &lt;i&gt;are &lt;/i&gt;direct ancestors.&amp;nbsp; So, where do we draw the research line?&amp;nbsp;&amp;nbsp;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;Would it be right to clone a Neandertal, even in the artificial sense just described?&amp;nbsp; Would the new individual be allowed to be experimented on, tested for HIV susceptibility or dissected to see how many lobes in its liver, its brain scanned under various conditions, or put on display?&amp;nbsp; Or would it have human rights--to go to school, to a human home rather than a cage, to vote?&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;In the 19th century there were strong moves against the torture of animals by science, called 'anti-vivisection' movements, and their descendants are the animal rights groups today.&amp;nbsp; There are many legitimate reasons to ask whether we should do &lt;i&gt;any&lt;/i&gt; experiments on animals, and whether understanding human biology or disease justifies it.&amp;nbsp; The response generally is that of course scientists are going to do it whether it's particularly humane or not, but that we do have at least some restraints on the pain and fear etc. we can inflict, and on what species.&amp;nbsp; Also, of course, we do raise and kill many animals to eat, and we're perfectly sanguine about asphyxiating zillions of fish a day so we can eat them.&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: left;"&gt;So, taking care of chimps seems like an unambiguously good thing to do.&amp;nbsp; But it does raise deeper questions.&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2598607499206655945?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2598607499206655945/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/chimps-looking-back-at-us.html#comment-form' title='11 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2598607499206655945'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2598607499206655945'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/chimps-looking-back-at-us.html' title='Chimps looking back at us'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-BFa83C2UFdE/Tu5AYIgAczI/AAAAAAAACMo/eGuo6eq2x40/s72-c/chimpanzee_criteria_sized.jpg' height='72' width='72'/><thr:total>11</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2468304089117350426</id><published>2011-12-16T05:03:00.022-05:00</published><updated>2011-12-16T05:50:54.284-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='methanogens'/><category scheme='http://www.blogger.com/atom/ns#' term='metagenomics'/><category scheme='http://www.blogger.com/atom/ns#' term='microbes'/><category scheme='http://www.blogger.com/atom/ns#' term='convergence'/><category scheme='http://www.blogger.com/atom/ns#' term='permafrost'/><title type='text'>Metagenomics in action</title><content type='html'>'Metagenomics', the direct sequencing of all the DNA found in environmental samples.&amp;nbsp; From one perspective, this is yet another 'omics', a way to keep all those expensive sequencing machines going.&amp;nbsp; And a way to avoid having to have hypotheses about what's going on in nature before you start your project--a somewhat strange twist in modern biology.&amp;nbsp; Still, 'omics' is done because we have the tools to do it and because it does promise to find something, on the single underlying assumption, namely, that something is there, even if we don't know what it might be.&lt;br /&gt;&lt;br /&gt;In fact an interesting use of this methodology is reported in &lt;i&gt;Nature&lt;/i&gt; this week, in a &lt;a href="http://www.nature.com/nature/journal/v480/n7377/full/nature10576.html"&gt;paper&lt;/a&gt; about the sequencing of all the microbes in Alaskan permafrost soil samples pre- and post-thaw. &amp;nbsp;The paper reports rapid changes in the abundance of many phylogenetic and functional genes and pathways, suggesting a rapid response to changing environment.&amp;nbsp; In this case, there need not have been any kind of &lt;i&gt;a priori&lt;/i&gt; hypothesis about what one would specifically find for this to be a valuable kind of work, which this study has proven to be.&lt;br /&gt;&lt;div&gt;&lt;br /&gt;&lt;/div&gt;&lt;div&gt;Mackelprang et al. collected 3 frozen soil cores from an area in Alaska that they had previously characterized. &amp;nbsp;They removed samples from these and let them thaw over 7 days. &amp;nbsp;They monitored the carbon dioxide and methane concentrations in the headspace of the helium filled tubes in which the samples were incubated, and extracted DNA for 16S ribosomal RNA and metagenome sequencing.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;&lt;/div&gt;&lt;div&gt;The authors were particularly interested in what happened to the methane and carbon dioxide because, of course, these are greenhouse gases. &amp;nbsp;They document changing levels of these gases as the soil samples thawed, and corresponding increases in genes in their metagenome from microbes that produce these gases as metabolic byproducts. &amp;nbsp; &lt;/div&gt;&lt;div&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-mSaa4HhZF24/TuoJTEMNROI/AAAAAAAACMc/r6q_eUsf-p8/s1600/Slide1.jpg" imageanchor="1"&gt;&lt;img border="0" height="300" src="http://1.bp.blogspot.com/-mSaa4HhZF24/TuoJTEMNROI/AAAAAAAACMc/r6q_eUsf-p8/s400/Slide1.jpg" width="400" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;br /&gt;&lt;/div&gt;Specifically:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;The metagenome data revealed core-specific shifts in some community members&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;, including the orders Proteobacteria, Bacteriodetes and Firmicutes. We found that Actinobacteria increased in both cores during thaw.&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;&amp;nbsp;Actinobacteria have previously been found at high abundance in permafrost&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;, which is thought to be caused by their maintenance of metabolic activity and DNA repair mechanisms at low temperatures&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;. Most archaeal sequences identified in the metagenomic data were methanogens in the phylum Euryarchaeota (62–95%), including the Methanomicrobia that was represented in our draft genome. In total, four orders of methanogens (Methanosarcinales, Methanomicrobiales, Methanomicrobia and Methanobacterales) were detected. As the permafrost thawed, the methanogens (including Methanomicrobia) increased in relative abundance&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;. These orders are known to be metabolically versatile and can use a variety of substrates&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;.&lt;/span&gt;&lt;/blockquote&gt;They also found that methane was consumed post-thaw. &amp;nbsp;But, to us what is most interesting about this, not being climatologists or microbiologists, is what they found about the differences between samples post-thaw, as they describe here.&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;We tracked simultaneous shifts in the total gene complement from the metagenome data to obtain a global view of functional response to thaw. The active layer samples were relatively similar before and after thaw. By contrast, the two frozen permafrost metagenomes differed dramatically before thaw&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;. In addition, functional genes in frozen active layer and permafrost samples were distinct from each other, including differences in several key metabolic pathways such as energy metabolism, nitrogen fixation, amino-acid transport, oxidative phosphorylation and anaerobic respiration&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;. During thaw, the permafrost metagenomes rapidly converged and neared those in the active layer samples&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;. &lt;b&gt;The convergence of function was not matched by a convergence of phylogenetic composition during this short-term incubation&lt;/b&gt;&lt;/span&gt;&lt;span class="Apple-style-span" style="font-family: arial, helvetica, clean, sans-serif; font-size: 13px; line-height: 19px;"&gt;&lt;b&gt;, suggesting that disparate community responses to thaw can have similar functional consequences.&lt;/b&gt;&lt;/span&gt;&lt;/blockquote&gt;As we said yesterday in our &lt;a href="http://ecodevoevo.blogspot.com/2011/12/major-evolutionary-transition-explained.html"&gt;post&lt;/a&gt; about ostrich penises, however the job can get done, evolution can support it.&amp;nbsp; Whether or not the job&amp;nbsp;being done here is good or bad for humans vis-à-vis climate change is another story.&amp;nbsp; But, convergence of function in the communities of microbes analyzed by these researchers happened in communities with very different compositions of microbes.&lt;br /&gt;&lt;br /&gt;Organisms have responsive genomes. Indeed, the 'job' of cells is to sequester their special ingredients within, but to monitor the external environment to determine how to behave most successfully.&amp;nbsp; They are changeable, within their genomic repertoire.&amp;nbsp; Mutation followed by natural selection can lead to specific genetically committed responses, but that isn't always necessary, because due to whatever earlier processes, even humble microbes have evolved to be able to respond to the conditions they find themselves in.&amp;nbsp; And, whether or not warming temperatures are beneficial to &lt;i&gt;specific &lt;/i&gt;microbes, the &lt;i&gt;community &lt;/i&gt;adapts.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;Based on comparative morphology and modern-day science, roughly 4 billion-year-old aggregates of bacteria (fossil biofilms calleld&amp;nbsp; 'stromatolites') look strikingly like their modern descendants.&amp;nbsp; Today, biofilms are known to be bacterial responses to changes in conditions--even different species can aggregate in the same biofilm.&amp;nbsp; This means that not that long after the origin of life (and, indeed, of the earth itself), fundamental facultative adaptability had already been built by evolution into the genomes of the earliest cells--and that means it is a basic property &lt;i&gt;of &lt;/i&gt;cells.&amp;nbsp; This is a point we stress in our book, &lt;i&gt;The Mermaid's Tale&lt;/i&gt;, and we're always gratified to see it confirmed.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2468304089117350426?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2468304089117350426/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/metagenomics-in-action.html#comment-form' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2468304089117350426'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2468304089117350426'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/metagenomics-in-action.html' title='Metagenomics in action'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-mSaa4HhZF24/TuoJTEMNROI/AAAAAAAACMc/r6q_eUsf-p8/s72-c/Slide1.jpg' height='72' width='72'/><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2048473769516743570</id><published>2011-12-15T05:53:00.002-05:00</published><updated>2011-12-15T05:53:00.589-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='ratites'/><category scheme='http://www.blogger.com/atom/ns#' term='phenogenetic drift'/><category scheme='http://www.blogger.com/atom/ns#' term='lymphatic erection'/><title type='text'>A major evolutionary transition explained</title><content type='html'>&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://3.bp.blogspot.com/-rCrn2EHejfk/TudeeE5AhII/AAAAAAAACMU/AbqjDqKJng4/s1600/_57231242_ostritch-anup-shah-smaller.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" height="110" src="http://3.bp.blogspot.com/-rCrn2EHejfk/TudeeE5AhII/AAAAAAAACMU/AbqjDqKJng4/s200/_57231242_ostritch-anup-shah-smaller.jpg" width="200" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;Photo from the BBC website&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;It's difficult to compete with the Higgs Boson story, but &lt;a href="http://www.bbc.co.uk/nature/16112188"&gt;here&lt;/a&gt;'s a strong second, a &lt;i&gt;hot &lt;/i&gt;breaking story on the BBC web site about erections in big birds (note, the picture shows the birds, so you'll know what we're talking about, but the erect structures in the picture are &lt;i&gt;necks&lt;/i&gt;&lt;i&gt;&lt;/i&gt;).&amp;nbsp; The story starts out: &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;div class="introduction" id="story_continues_1"&gt;&lt;b&gt;Ostriches have bloodless erections, according to researchers.&lt;/b&gt;&lt;/div&gt;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;The large birds were previously thought to have blood-based erection mechanisms similar to humans.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;But scientists from Yale University, US, have now confirmed that the birds actually enlarge their penises with lymph fluid. &amp;nbsp;&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;All other birds with a penis achieve erections in this way,  leading scientists to believe the mechanism evolved in their ancient  ancestors.&lt;/blockquote&gt;The &lt;a href="http://onlinelibrary.wiley.com/doi/10.1111/j.1469-7998.2011.00858.x/full"&gt;paper &lt;/a&gt;itself is published in the &lt;i&gt;Journal of Zoology&lt;/i&gt;.&amp;nbsp; The authors explain in the abstract why it's so important:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Because the penis in all other described birds has a lymphatic erection  mechanism, clarifying that the erection mechanism of ratites [large flightless birds] is of  great importance to understanding one of the major evolutionary  transitions of penis morphology within amniotes. Here, we show that the  erection mechanism of ratites is lymphatic, confirming that the  evolutionary transition to lymphatic erection occurred in the last  common ancestor of Aves.&lt;/blockquote&gt;You'd always wondered about the&lt;i&gt;&amp;nbsp;&lt;/i&gt;major evolutionary transitions of penis morphology, hadn't you? &lt;br /&gt;(Actually, though, this may not have been as pressing a question as it seemed at the time, given another recent breaking story: men don't think about sex as often as their reputation  has lead us all to believe, proven by a &lt;a href="http://men.webmd.com/news/20111129/men-dont-always-think-about-sex"&gt;study &lt;/a&gt;that asked men how often they thought about sex.&amp;nbsp; &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;"The absolute number of sexual thoughts is dramatically less than the  urban legend that men think about sex every seven seconds," says study  researcher Terri Fisher, PhD, professor of psychology at The Ohio State University at Mansfield.&lt;/blockquote&gt;Men were asked to push a button on a counter every time they had a sexual thought.&amp;nbsp; But, we wonder, isn't it possible that the count was artificially reduced by the subjects' thumbs tiring of pushing the freaking button?)&amp;nbsp; &lt;br /&gt;&lt;br /&gt;But, back to the story at hand, ratite penises.&amp;nbsp; There was a suggestion long ago of lymphatic involvement in the erections of flightless birds, but it remained unconfirmed until now.&amp;nbsp; After all, who dared to look? &amp;nbsp;These guys bite hard! &amp;nbsp;(Hard to do it, but we're resisting the temptation to make a pecker joke here.) &amp;nbsp;Instead, the authors were sent ostrich and emu penises from birds of reproductive age (that is, certified to be &lt;i&gt;adults&lt;/i&gt;, if you're worried that we're writing this from Penn State), and they dissected them -- for methodological and anatomical details, see the paper, but suffice it to say that their work confirms the old suspicion.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;It &lt;i&gt;is &lt;/i&gt;rather surprising that this wasn't known until now, and the authors of the paper briefly describe why this is so, including something tantalizing about a reference gone missing.&amp;nbsp; Indeed, there are a lot of citations in the paper of "unpublished data" on bird penile morphology.&amp;nbsp; So, it's even more surprising that all it took to answer this question was a bit of dissection of the relevant organs.&amp;nbsp; Now done.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;The story on the BBC reports that there are still unanswered evolutionary questions, however (there must be, or the specialists would be out of a job).&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Similarities have been drawn in the past between bird and reptile penises but the latter use blood for erections, as do mammals.         &lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;"The reason why the change between blood vascular and lymphatic took place remains a mystery," said Dr Brennan.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;"The lymphatic system is a low pressure system, so this means  that erection cannot be maintained, and this has some important  implications for how birds actually copulate," said Dr Brennan.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;Some species of bird, such as ducks, are known for their  "explosive" erections achieved when lymph fluid is forced into the penis  to increase pressure for a short time.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;But ornithological reproduction expert Prof Tim Birkhead from  the University of Sheffield suggests that the structure of ostrich  penises could make up for the shortcomings of the lymph system.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;"Ostriches and rheas appear to have additional muscles that help to maintain a rigid phallus," he explained. &lt;/blockquote&gt;Ok, so is this actually of interest, other than as a footnote to the sexual life of birds? &amp;nbsp;Because, after all, however erections happen in these birds, the mechanism has worked for a very long time (except for the dodo and the roc). &amp;nbsp;The authors say this is an important contribution to the understanding of the evolution of penis morphology. &amp;nbsp;We have to take their word for it, though this does seem to be a rather specialized interest -- yet another science paper detailing perfectly good work, but that didn't warrant all this fuss. &lt;br /&gt;&lt;br /&gt;Is there even a general lesson here? &amp;nbsp;Well, it's yet another of the myriad examples of variation underlying a single trait or mechanism -- if it does the job, evolution can support it. &amp;nbsp;Nothing new here. &amp;nbsp;Indeed, the genetics underlying many examples of what's called 'phenogenetic drift' -- many genetic pathways to a given trait -- are well-documented (Kazu Kawasaki in our lab has done a lot of work on the evolution of genes for mineralization in multiple lineages, for example, a beautiful example of phenogenetic drift; same trait, even under strong selection, yet produced by different genes in different individuals, populations, or times).&amp;nbsp; So the fact that there are different erectile mechanisms isn't at all a surprise, just another variant in the wide spectrum of how organisms reproduce. &lt;br /&gt;&lt;br /&gt;What makes this story manage to stand tall in the news makes it harder, to fathom.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2048473769516743570?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2048473769516743570/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/major-evolutionary-transition-explained.html#comment-form' title='6 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2048473769516743570'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2048473769516743570'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/major-evolutionary-transition-explained.html' title='A major evolutionary transition explained'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/-rCrn2EHejfk/TudeeE5AhII/AAAAAAAACMU/AbqjDqKJng4/s72-c/_57231242_ostritch-anup-shah-smaller.jpg' height='72' width='72'/><thr:total>6</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-617862159481642864</id><published>2011-12-14T05:13:00.002-05:00</published><updated>2011-12-14T05:13:00.397-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='big science'/><category scheme='http://www.blogger.com/atom/ns#' term='Higg&apos;s Boson'/><title type='text'>A Pig's Nose-on?</title><content type='html'>The news we've all been paying....er, waiting (but not praying)...for is now out, or at least the installment that says we may have found something, it may be definitive, but we need billions more to be sure because it may not.&amp;nbsp; Your life will be different now that there might, or could, possibly perhaps be a Higgs boson, that elusive thing that puts the lead in your pencil, so to speak--gives mass to fundamental particles--without which you would wither away to a mere nothing (like Higgsy hopefully won't).&lt;br /&gt;&lt;br /&gt;Well, as the figure shows, Higglety Pigglety, it really &lt;i&gt;is &lt;/i&gt;a mere nothing (well, near-nothing if it exists, or nothing if it doesn't).&amp;nbsp; The arrow points to the teensy, weensy, boson flying around amidst a cloud of dust particles or nuons or neutrinos, or something like that.&amp;nbsp; Now don't be cynical, and think this is just a screenshot from some video game.&amp;nbsp; Yes, it resembles the Droid logon screen, too.&amp;nbsp; But believe us, it's the real thing (if the real thing exists).&lt;br /&gt;&lt;br /&gt;&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-0AklotBlb4Q/TueWZKasX1I/AAAAAAAAAHE/Iv_Xgtu46MU/s1600/HiggsEureka.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" src="http://1.bp.blogspot.com/-0AklotBlb4Q/TueWZKasX1I/AAAAAAAAAHE/Iv_Xgtu46MU/s1600/HiggsEureka.jpg" /&gt;&lt;/a&gt;&lt;/div&gt;&lt;br /&gt;&lt;br /&gt;What we're seeing today is by now a standard marketing strategy: a carefully timed media announcement event.&amp;nbsp; A claim that we've now got it, the Big Finding, but it's only the beginning.&amp;nbsp; That doesn't make it a false announcement, but there is still the possibility that this is a Pig's nose-on some junk scraps rather than a Higgs boson some scraps of detector signal.&amp;nbsp; Whether this is beauty or beast only time will tell.&lt;br /&gt;&lt;br /&gt;It's easy (and justified?) to have some fun with this long played out Lamborghini of a science story (given its cost), but it again reflects the current view that science must now address Very Big questions on a huge long-term scale.&amp;nbsp; The rationale is that small studies can't get at the complex or minute effects that we have to find in a sea of data.&amp;nbsp; Small-scale experimentation may be in order once the 'signal' is found, to understand it in detail, but the prevailing idea is that by and large the easily findable big effects are already known.&amp;nbsp; In genetics, for example, the rationale is, as well, that small effects on individuals if they're common can lead to large numbers of affecteds on a population scale (100 million people at a risk of one in 100,000 would mean 1000 individuals affected), or that some very strong effects that are so rare they could never generate statistically convincing evidence on their own might in fact be devastating to those few people that inherit them.&lt;br /&gt;&lt;br /&gt;This is true, in theory, in physics as well. The Higgs boson affects every bit of matter, including you, your eyes reading the screen, and the screen itself.&amp;nbsp; So this is a trivially small physical effect individually but a totally profound one in the overall scheme of the cosmos.&amp;nbsp; It is claimed that (if it actually exists) it will tie together many loose threads in theoretical physics.&amp;nbsp; Lots of jobs and work to do for physicists, and maybe even stimulation for biologists to ask themselves whether there is something fundamental missing from &lt;i&gt;our &lt;/i&gt;thinking.&lt;br /&gt;&lt;br /&gt;Whether or when it will have any direct effect on anyone other that students in Physics classes, only the media hype-engine knows (Whether it's real or not, it may show up on their exams!).&amp;nbsp; It is edifying and elegant, as is the experiment to hunt ol' Higgsy down, if true.&amp;nbsp; For the middle class it may seem worth its cost, and it may be better than most television (and will generate countless television specials as well).&amp;nbsp; But, just as whether big genomic science is worth the cost to those billions barely scraping a living together, with less than a boson's worth to eat, is another story.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-617862159481642864?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/617862159481642864/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/pigs-nose-on.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/617862159481642864'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/617862159481642864'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/pigs-nose-on.html' title='A Pig&apos;s Nose-on?'/><author><name>Ken Weiss</name><uri>http://www.blogger.com/profile/02049713123559138421</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-0AklotBlb4Q/TueWZKasX1I/AAAAAAAAAHE/Iv_Xgtu46MU/s72-c/HiggsEureka.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2578491101238620041</id><published>2011-12-13T05:44:00.032-05:00</published><updated>2011-12-13T05:44:00.869-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='epidemiology'/><category scheme='http://www.blogger.com/atom/ns#' term='vitamin D'/><category scheme='http://www.blogger.com/atom/ns#' term='causation'/><category scheme='http://www.blogger.com/atom/ns#' term='multiple sclerosis'/><title type='text'>Progress on MS, and a somewhat typical genetics story</title><content type='html'>&lt;div class="separator" style="clear: both; text-align: center;"&gt;&lt;a href="http://2.bp.blogspot.com/-7Sm87bjCjKc/TuZxnasjXiI/AAAAAAAACMM/3Q2h4okLFfo/s1600/sun+wiki.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="160" src="http://2.bp.blogspot.com/-7Sm87bjCjKc/TuZxnasjXiI/AAAAAAAACMM/3Q2h4okLFfo/s200/sun+wiki.jpg" width="200" /&gt;&lt;/a&gt;&lt;/div&gt;Multiple sclerosis (MS) is yet another chronic often devastating disease for which cause is not known.&amp;nbsp; Some epidemiological studies suggest an infectious cause, since cases often clusters geographically, but the fact that prevalence tends to increase with distance from the equator in childhood or adolescence has suggested to other researchers a link with sunlight exposure, and thus perhaps to vitamin D deficiency, because sunlight is important to vitamin D synthesis.&amp;nbsp; Because causation isn't clear, many also suggest a gene-by-environment interaction, in which some genetic variants react differently to a given environmental factor than other variants do.&amp;nbsp; And now a new study, reported all over the web, including &lt;a href="http://www.bionews.org.uk/page_115205.asp"&gt;here&lt;/a&gt;, and published in the &lt;i&gt;Annals of Neurology&lt;/i&gt; (&lt;a href="http://onlinelibrary.wiley.com.ezaccess.libraries.psu.edu/doi/10.1002/ana.22678/pdf"&gt;here&lt;/a&gt;, with subscription), reports a genetic link to vitamin D and risk of MS.&lt;br /&gt;&lt;br /&gt;MS is an autoimmune disease characterized by degradation of the myelin sheath that surrounds and protects nerve cells.&amp;nbsp; The sheath is like insulation in electric wires, and protects the nerve signal from dissipating as it travels from the brain to where its action is triggered.&amp;nbsp; Nerve damage occurs due to the inflammation that happens when the body's immune cells attack the nervous system, interrupting the signals sent along the affected nerves.&amp;nbsp; Sex and age are related to risk, and among sufferers the symptoms vary widely, depending on which nerves are damaged.&amp;nbsp; Prognosis also varies widely, and is difficult to predict.&amp;nbsp; Many studies, including but long before GWAS, have found HLA class II genes, and others with modest effect, but the effect varies by whether cases are sporadic or familial.&amp;nbsp; This all suggests that the disease is heterogeneous, with varied causation -- not at all unusual for complex chronic diseases (nor even for 'simple' genetic disease). &amp;nbsp;&amp;nbsp; &lt;br /&gt;&lt;br /&gt;The aim of the study just reported, carried out by Oxford researchers in collaboration with colleagues at the University of Ottawa in Canada, was to look for rare genetic variants that might explain the excess of cases in some of the 30,000 families participating in a Canadian study of MS, although they do point out that shared family environment could be important.&amp;nbsp; They began by sequencing the exomes -- all the gene coding regions -- of a randomly selected affected individual from 43 of the 82 families with four or more members with MS (a fairly rare occurrence given that there seems to be a genetic component to risk). &amp;nbsp;Using families with multiple affected members is well-known to increase the likelihood of finding relative simple and tractable genetic causation.&amp;nbsp; They didn't in fact find any shared rare variants in this way, so they then focused on MS genes identified in previous GWA studies they had done, that is, comparing cases with unrelated controls. &lt;br /&gt;&lt;br /&gt;This eventually led them to zero in on a single change in the CYP27B1 gene that was shared by at least one unaffected parent in the multiply affected families, and by all the affected members.&amp;nbsp; This is a candidate gene previously tentatively suggested by a GWA study.&amp;nbsp; They used data from 3046 additional parent-affected child trios, 422 parent-affected sibling pairs and 1873 healthy individuals (in total 12,579 people) from their study to replicate their results&lt;b&gt;. &amp;nbsp;&lt;/b&gt;&lt;br /&gt;&lt;br /&gt;As reported in the story in MedicalExpress, the lead author, George Ebers at Oxford, concluded: &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;"The odds are very much less probable than being hit by lightning", he said. "Is this gene variant causative in multiple sclerosis? Pretty  much! The cornerstone for causation has always been the strength of  association."&lt;/blockquote&gt;Further, this mutation is known to be associated with low levels of vitamin D, which implies that MS is somehow linked with vitamin D levels.&amp;nbsp; In the rare instances when people have 2 copies of this variant, they also have rickets, which is also associated with vitamin D levels.&amp;nbsp;&amp;nbsp; From the conclusion to the paper:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Most biological effects of vitamin D are mediated by calcitriol acting via the vitamin D receptor (VDR). We have previously shown that vitamin D regulates more than 80% of MS associated genes 25, and thus it is likely that lower levels of calcitriol as a result of CYP27B1 mutations leads to a disruption to critical gene-environment interactions important for the developing immune or nervous system which then predisposes to MS.&lt;/blockquote&gt;Indeed, because there are unaffected family members with the mutation -- it was present in 33% of genotyped unaffected family members -- clearly any genetic cause here is more complex than one-to-one.&amp;nbsp; Or, in rather imprecise genetic jargon, it's "incompletely penetrant".&amp;nbsp; And indeed, it's a rare variant, present in only a subset of people with MS.&amp;nbsp; And, clearly, if there is a vitamin D component to causation, it's also not one-to-one, because while prevalence of MS is higher in higher than lower latitudes, it's still a fairly rare disease, even in people with low levels of vitamin D.&amp;nbsp; The idea of the latitude effect has long been thought to involve sunlight exposure amounts, but other things are correlated with latitude, including immune exposures.&amp;nbsp; So, as with most complex chronic diseases, causation doesn't come down to simply one mutation or one environmental factor.&lt;br /&gt;&lt;br /&gt;The study does appear to implicate vitamin D biology, though in a curious way since the penetrance even of the clearest alleles is far from complete. There are either many pathways to MS, or there is a specific as yet unspecified subset of the diseases with this causation. &amp;nbsp;It's not really clear what fraction of risk this new gene explains, but the point is not that the gene 'for' MS has been found, but that this particular mutation is associated with low vitamin D levels, as well as some risk of MS. &amp;nbsp;The roughly 4-1 female-male sex ratio for MS in general, and its usually adult onset, and highly variable pathology all point to very stochastic (probabilistic) effects and/or cofactors that mean there is still much to learn.&amp;nbsp;&amp;nbsp; But this may be a case where GWAS have made a somewhat greater than usual contribution to risk, not by identifying genes with strong effects but rather by suggesting a train of thought that may perhaps lead to more systematic understanding of a devastating disease.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2578491101238620041?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2578491101238620041/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/progress-on-ms-and-somewhat-typical.html#comment-form' title='5 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2578491101238620041'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/2578491101238620041'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/progress-on-ms-and-somewhat-typical.html' title='Progress on MS, and a somewhat typical genetics story'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-7Sm87bjCjKc/TuZxnasjXiI/AAAAAAAACMM/3Q2h4okLFfo/s72-c/sun+wiki.jpg' height='72' width='72'/><thr:total>5</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-9089506947215378401</id><published>2011-12-12T05:05:00.000-05:00</published><updated>2011-12-12T05:05:00.256-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='technology'/><category scheme='http://www.blogger.com/atom/ns#' term='gene therapy'/><category scheme='http://www.blogger.com/atom/ns#' term='Hemophilia B'/><title type='text'>Some things really are 'genetic'!  And let's do something about them!</title><content type='html'>It's not exactly a secret that we are very skeptical about what we believe is the hyper-geneticizing of life, both in terms of what we think are simplistic evolutionary just-so scenarios, and raising of hopes for simplistic predictability between your genome and everything about you.&lt;br /&gt;&lt;br /&gt;But our traits have to come from somewhere, and manifestly much of this is inherited and just as clearly much of this involves genes.&amp;nbsp; Not only do genes (here we use the term broadly for DNA-based functions, not just protein coding) carry out biological function, but variation in genes is causally associated with variation in function.&amp;nbsp; And, of course, our genomes evolved by processes that, yes, included natural selection.&lt;br /&gt;&lt;br /&gt;Our point has consistently (we hope) been that evolutionary processes generally lead to more complex, multigenic, less causally deterministic traits than is the current working model (or hyperbole).&amp;nbsp; On the other hand, life is a spectrum of genetic causal effects.&amp;nbsp; Most are small, and the responsible variants rare and geographically local, and most traits are due to the aggregate effects of many genes.&amp;nbsp; But the spectrum has its more strongly causal segment as well.&amp;nbsp; Some traits really are genetic in all the usual senses of the term.&amp;nbsp;&amp;nbsp; Included among them are many diseases, usually congenital, severe, and relatively rare in the population.&lt;br /&gt;&lt;br /&gt;For these really genetic traits, one or a few genes are responsible, and for associated diseases perhaps specific variants in those genes.&amp;nbsp; These present completely appropriate (socially responsible as opposed to eugenic) targets for all sorts of intervention or preventive measures.&amp;nbsp; Here, we enter the realm of clear causation and hence focused technological approaches.&amp;nbsp; Simple causation of this kind is reasonably thought to be vulnerable to highly targeted gene-based pharmacology (serving as 'druggable' targets).&amp;nbsp; And these traits also are appropriate for gene therapy, that is, to try to replace a defective gene with a healthily functioning one.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;Now organisms don't like to be messed with, and often tend to resist, and individual defective cells may be located in inaccessible parts of the body, and so on.&amp;nbsp; But one should never bet against technology when it has, as in this case, an appropriate problem to solve.&amp;nbsp; For that reason, we have written and said elsewhere that one should not be too impatient at failures of Pharma or gene gene technology to solve these problems.&amp;nbsp; They are tough problems!&amp;nbsp; Still, don't bet against technology.&lt;br /&gt;&lt;br /&gt;And&amp;nbsp;&lt;a href="http://www.nytimes.com/2011/12/11/health/research/hemophilia-b-gene-therapy-breakthrough.html?scp=1&amp;amp;sq=gene%20therapy&amp;amp;st=cse"&gt;here's&lt;/a&gt; a story about gene therapy that seems to be working. &amp;nbsp;The story, in yesterday's &lt;i&gt;NYT&lt;/i&gt;, reports some success in treating Hemophilia B, a disease caused by mutations in the gene for Factor IX, an X-linked gene (so that the disease is almost exclusively found in males), that lead blood not to clot, because the missing protein is needed in the clotting interactions.&amp;nbsp; Hemophilia has storied associations with European royalty and hemophiliacs were tragically affected by needing transfusions that they received from donors affected with HIV, until such testing and screening became effective.&amp;nbsp; But if there is a single defective gene, an obvious thing to try is to develop a modified virus as a vector (carrier) of a healthy gene.&amp;nbsp; The virus is structured so that in a particular target cell (in this case, the liver) it will express the normal human gene, but will not be harmful itself.&amp;nbsp; In the trials that have just been reported, the newly expressed exogenously introduced gene produced the missing clotting factor, secreted it into the blood stream, and the patient's blood then could clot more or less normally.&lt;br /&gt;&lt;br /&gt;The effect was temporary (because of cell turnover in the patient), and not 100% in all tested individuals.&amp;nbsp; And because the patient's body resists foreign invaders--like viruses!--it developed antibodies to the injected vector, so that the treatment couldn't be repeated (the virus would be destroyed before it could get into the host's cells).&amp;nbsp; So this trial is only a first step.&amp;nbsp; But it showed that the idea can work, even if various tricks will have to be developed to get around or to suppress immune resistance to the treatment.&lt;br /&gt;&lt;br /&gt;If the problem is simple enough, as some genetic problems are, then solutions can be expected, even if not always immediately.&amp;nbsp; In genetics as in electronics, never bet against technology.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-9089506947215378401?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/9089506947215378401/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/some-things-really-are-genetic-and-lets.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/9089506947215378401'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/9089506947215378401'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/some-things-really-are-genetic-and-lets.html' title='Some things really are &apos;genetic&apos;!  And let&apos;s do something about them!'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-6195816272721324382</id><published>2011-12-09T10:07:00.000-05:00</published><updated>2011-12-09T10:16:20.898-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='mutation'/><category scheme='http://www.blogger.com/atom/ns#' term='environmental factors'/><category scheme='http://www.blogger.com/atom/ns#' term='complexity'/><category scheme='http://www.blogger.com/atom/ns#' term='phenotype'/><title type='text'>Random gene expression really can be random</title><content type='html'>It's rather surprising that authors of a &lt;a href="http://www.nature.com/nature/journal/v480/n7376/full/480188a.html"&gt;commentary &lt;/a&gt;("Genetics: Noise rules") for a major science journal (&lt;i&gt;Nature&lt;/i&gt;) feel the need to remind people that identical twins don't always have the same personalities or the same disease risk.&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Notable advances in DNA sequencing during the past few years have made  it possible to define the genotype of any individual rapidly and  cheaply. As a result, scientists glibly talk about the possibility of  pinpointing individual genes that influence every aspect of our being,  from our propensity to get cancer to our chances of living to be 100  years old. However, this appealing vision oversimplifies a much more  complex reality. There is no one-to-one relationship between genotype  and phenotype — even identical twins can have radically different  personalities, disease susceptibilities and life trajectories. &lt;/blockquote&gt;Astonishing.&amp;nbsp; Though what's truly astonishing is that so many scientists &lt;i&gt;do &lt;/i&gt;still glibly talk about genes for traits. Indeed, evolutionary psychology thrives, genetics percolates into fields like economics, and direct-to-consumer companies sell the promise of prediction from genes to (too) many believing customers.&lt;br /&gt;&lt;br /&gt;Heritability in twin studies is almost always far from 100%, clearly showing that environment plus statistical variation (chance aspects of development, exposures, mutations, and so on) are important, even if the inherited genome is identical (but every cell division introduces new mutations, so even identical twins are not identical in their genes, any more than &lt;i&gt;you &lt;/i&gt;are in the genomes in your different cells!). &lt;br /&gt;&lt;br /&gt;But, clearly people still need to hear the message, whether or not it sinks in.&amp;nbsp; And the message in a &lt;a href="http://www.nature.com/nature/journal/v480/n7376/full/nature10665.html"&gt;paper &lt;/a&gt;in this week's &lt;i&gt;Nature &lt;/i&gt;by Ben Lehner et al. is that phenotype is due to 'noise' -- random gene expression -- and the fact that genes act together with other genes to 'form functional cellular networks'.&amp;nbsp; That is, genetic background determines the effect any given allele has on phenotype.&amp;nbsp; Why this is &lt;i&gt;Nature&lt;/i&gt;-worthy isn't entirely clear, given that both phenomena are well-known -- perhaps because it is elegantly demonstrated.&lt;br /&gt;&lt;br /&gt;The authors wondered why so many mutations only have a detrimental effect on a subset of individuals who carry them.&amp;nbsp; Genetic background and gene by environment interactions are the usual answer, but what about incomplete penetrance?&amp;nbsp; That is, the situation where an allele isn't expressed, or isn't completely expressed, for whatever reason.&amp;nbsp; They propose 'a model for incomplete penetrance based on genetic interaction networks.'&lt;br /&gt;&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://4.bp.blogspot.com/-Te-tg5mqOFQ/TuIlmLU61yI/AAAAAAAACME/BFpR-RI9kTQ/s1600/CrawlingCelegans.gif" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" src="http://4.bp.blogspot.com/-Te-tg5mqOFQ/TuIlmLU61yI/AAAAAAAACME/BFpR-RI9kTQ/s1600/CrawlingCelegans.gif" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;C. elegans;&amp;nbsp; public domain photo &lt;a href="http://labs.bio.unc.edu/Goldstein/movies.html"&gt;Bob Goldstein&lt;/a&gt;&lt;/td&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;&lt;br /&gt;&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;&lt;br /&gt;Briefly, using the &lt;i&gt;C elegans&lt;/i&gt;, a tiny and very well-characterized worm, as their model, the proposed "that in the absence of additional genetic variation, it is  stochastic variation in the abundance or activity of genetic interaction  partners (genes that influence the outcome of a mutation when  genetically altered) that determines the outcome of a mutation."&lt;br /&gt;&lt;br /&gt;To test their hypothesis, among other things, they looked at the effects of a mutation in a known transcription factor gene, &lt;i&gt;tbx-9&lt;/i&gt;.&amp;nbsp; Half of the mutant worms had abnormal development of the epidermis and muscle -- that is, effects of the mutation were incompletely penetrant.&amp;nbsp; &lt;i&gt;Tbx-9 &lt;/i&gt;is related to another transcription factor, &lt;i&gt;tbx-8&lt;/i&gt;, and inactivation of &lt;i&gt;tbx-8&lt;/i&gt; causes incompletely penetrant defects as well, but loss of both genes is lethal.&amp;nbsp; And, while half of the worms lacking &lt;i&gt;tbx-9 &lt;/i&gt;develop normally, overexpression of &lt;i&gt;tbx-8&lt;/i&gt; eliminates the effects of &lt;i&gt;tbx-9 &lt;/i&gt;mutations, and loss of &lt;i&gt;tbx-9 &lt;/i&gt;upregulated &lt;i&gt;tbx-8&lt;/i&gt;.&amp;nbsp; Further, differences in &lt;i&gt;tbx-8 &lt;/i&gt;expression were a predictor of the effects of loss of &lt;i&gt;tbx-9.&lt;/i&gt;&amp;nbsp; &lt;br /&gt;&lt;br /&gt;However, variability of &lt;i&gt;tbx-8 &lt;/i&gt;expression didn't fully explain variation in expression of the &lt;i&gt;tbx-9 &lt;/i&gt;mutation.&amp;nbsp; The authors propose that the remaining variability is due to molecular chaperones, proteins that help other proteins to take their shape, that somehow dampen the effects of some mutations.&amp;nbsp; They found correlated fluctuation in penetrance of mutation effects with molecular chaperone levels.&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;Lehner and colleagues found that the observed variability in penetrance of &lt;i&gt;tbx-9&lt;/i&gt; loss in their study can, to a remarkable degree, be accounted for by variations in expression of &lt;i&gt;tbx-8&lt;/i&gt; and &lt;i&gt;daf-21&lt;/i&gt; [a chaperone gene]. &lt;/blockquote&gt;So, basically they are following a causative pathway, trying to explain what looks stochastic, but  that they propose can be explained molecularly.&amp;nbsp; What this means, in effect, is that phenotypic  variation that may appear random, is instead genetically determined, even if you have to climb up or down a genetic pathway to identify the causative genes.&lt;br /&gt;&lt;br /&gt;Incomplete penetrance is an interesting concept, because it assumes that there's a correct level of gene expression, and that anything short of that is not right and must be explained.&amp;nbsp; But deterministic explanations may not be as pervasive as the hunger for them is.&amp;nbsp; It has often been shown that stochastic levels of regulatory gene expression can make very large differences in response, even in&amp;nbsp; bacterial responses to environments.&amp;nbsp; Non-determinance is not mysticism, since probabilistic events involve real physical substances, so nobody thinks twins differ for miraculous reasons, but such things are not predictable in the usual sense and are not specifically determined by DNA sequence alone.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-6195816272721324382?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/6195816272721324382/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/its-rather-surprising-that-authors-of.html#comment-form' title='3 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/6195816272721324382'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/6195816272721324382'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/its-rather-surprising-that-authors-of.html' title='Random gene expression really can be random'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/-Te-tg5mqOFQ/TuIlmLU61yI/AAAAAAAACME/BFpR-RI9kTQ/s72-c/CrawlingCelegans.gif' height='72' width='72'/><thr:total>3</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-5213300181909312003</id><published>2011-12-08T05:34:00.000-05:00</published><updated>2011-12-08T14:17:03.844-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='risk factors'/><category scheme='http://www.blogger.com/atom/ns#' term='cause and effect'/><category scheme='http://www.blogger.com/atom/ns#' term='cancer'/><category scheme='http://www.blogger.com/atom/ns#' term='observational epidemiology'/><title type='text'>Does salt really cause cancer?</title><content type='html'>A new &lt;a href="http://www.nature.com/bjc/journal/v105/n2s/full/bjc2011474a.html"&gt;report &lt;/a&gt;on cancer incidence and mortality in the UK, &lt;a href="http://www.guardian.co.uk/society/2011/dec/07/cancers-prevented-lifestyle-changes-study"&gt;described &lt;/a&gt;on the Guardian website, suggests that 40% of cancers in women and 45% in men are preventable, due to lifestyle choices. This is great news for people pushing healthy diets and exercise (perhaps not such great news for those pushing genetic causation). &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Dr Rachel Thompson, deputy head of science for the World Cancer Research Fund, said: "This adds to the now overwhelmingly strong evidence that our cancer risk is affected by our lifestyles.&lt;/span&gt;&lt;/blockquote&gt;&lt;blockquote&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;"We hope this study helps to raise awareness of the fact that cancer is not simply a question of fate and that people can make changes today that can reduce their risk of developing cancer in the future.&lt;/span&gt;&amp;nbsp;&lt;/blockquote&gt;So, what is this overwhelmingly strong evidence? The authors chose 14 different risk factors, as listed in the table below (taken from the paper).&lt;br /&gt;&lt;br /&gt;&lt;div&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;b&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Table 1. Exposures considered, and theoretical optimum exposure level&lt;/span&gt;&lt;/b&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;b&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;Exposure&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;Optimum exposure&lt;/span&gt;&lt;/b&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Tobacco smoke &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Nil&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Alcohol consumption &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Nil&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;i&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Diet&lt;/span&gt;&lt;/i&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in; margin-left: 30pt; margin-right: 0in; margin-top: 0in; text-indent: -0.25in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;1.&lt;span style="font: 7pt 'Times New Roman';"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&lt;/span&gt;Deficit in intake of fruit and veg&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;≥5 servings (400 g) per day&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in; margin-left: 30pt; margin-right: 0in; margin-top: 0in; text-indent: -0.25in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;2.&lt;span style="font: 7pt 'Times New Roman';"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&lt;/span&gt;Red and preserved meat&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;Nil&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in; margin-left: 30pt; margin-right: 0in; margin-top: 0in; text-indent: -0.25in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;3.&lt;span style="font: 7pt 'Times New Roman';"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&lt;/span&gt;Deficit in intake of dietary fiber &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;≥23 g per day&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in; margin-left: 30pt; margin-right: 0in; margin-top: 0in; text-indent: -0.25in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;4.&lt;span style="font: 7pt 'Times New Roman';"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&lt;/span&gt;Excess intake of salt &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; ≤6 g per day&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Overweight and obesity &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;BMI ≤25 kb m&lt;sup&gt;-2&lt;/sup&gt;&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Physical exercise &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;≥30 min 5 times per week&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Exogenous hormones &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;Nil&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Infections &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Nil&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Radiation – ionizing&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;&amp;nbsp;Nil&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Radiation – solar (UV)&amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;As in 1903 birth cohort&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Occupational exposures &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; Nil&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0in;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;Reproduction: breast feeding &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp; &amp;nbsp;Min of 6 months&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;div style="margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px;"&gt;&lt;span class="Apple-style-span" style="font-family: Georgia,'Times New Roman',serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;&lt;/div&gt;The study calculated the "population attributable fraction" of each risk factor, that is, how much excess cancer was due to exposure to the risk factor.  They compared cancer incidence in those exposed with incidence in those not exposed and assumed any excess (or, in theory, deficit) was due to the risk factor.&lt;br /&gt;&lt;br /&gt;They chose risk factors based on the following criteria:&lt;br /&gt;1. There was sufficient evidence on the presence and magnitude of likely causal associations with cancer risk from high-quality epidemiological studies.&lt;br /&gt;2. Data on risk factor exposure were available from nationally representative surveys.&lt;br /&gt;3. There were achievable alternative exposure levels that would modify the risk.&lt;br /&gt;&lt;br /&gt;They calculated the relative risk per unit of exposure for cancers with probable or convincing causal associations with each risk factor, based on observational epidemiological studies.  These would be the same studies you see reported in the news every day, telling you that you should or shouldn't eat butter, should or shouldn't go out into the sun, should or shouldn't eat sugar.  &lt;br /&gt;&lt;br /&gt;But there is something rotten in the state of Denmark, because despite billions of dollars, hundreds of thousands of study subjects, countless studies over decades of time by the most prominent (or, that is, highly placed) epidemiologists, the actual truth about the data is very different, surprising as that may seem.  Indeed, as far as we know, the only truly convincing risk factors in this list are tobacco, papilloma virus and radiation, and even there it isn't really clear how much radiation exposure is too much (and many would say no exposure is the only completely safe exposure, though some exposures may detect treatable dangerous conditions and be good in the net).  &lt;br /&gt;&lt;br /&gt;The other behavioral risk factors have been shown in some studies to account for a small fraction of risk, though the results aren't always replicable. Indeed we can assert what we've just said because, by chance we just heard a talk by Gary Taubes, a science journalist for the New York Times and Science, among other outlets, who has systematically been debunking the idea that low fat diets have been shown definitively to prevent heart disease and cancer.  He says the data just aren't there and never have been, but that it's been a belief so entrenched that it can't be denied because of all the vested interest that would challenge.  &lt;br /&gt;&lt;br /&gt;Hey, we like a good heretic as much as the next guy.  And Taubes has written some of the best stuff out there on why observational epidemiology can't answer basic questions about cause and effect (&lt;a href="http://geography.ssc.uwo.ca/faculty/baxter/readings/Taubes_limits_epidemiology_Science_1995.pdf"&gt;here &lt;/a&gt;and &lt;a href="http://www.nytimes.com/2007/09/16/magazine/16epidemiology-t.html?ref=magazine"&gt;here&lt;/a&gt;, for example).  His &lt;a href="http://www.nytimes.com/2002/07/07/magazine/what-if-it-s-all-been-a-big-fat-lie.html?pagewanted=all&amp;amp;src=pm"&gt;work &lt;/a&gt;on dietary fat is very convincing, and his more general point that observational epidemiology can't be the basis for dietary recommendations is equally convincing.  (So it's confusing that he's now a strong advocate for the idea that processed &lt;a href="http://www.nytimes.com/2011/04/17/magazine/mag-17Sugar-t.html?pagewanted=all"&gt;sugar is toxic&lt;/a&gt;, and responsible for the obesity and diabetes epidemics all over the globe -- conclusions largely based on the same kinds of observational studies he debunks when it comes to risk factors he doesn't like.)&lt;br /&gt;&lt;br /&gt;But we digress.  We are more than willing to accept that environmental risk factors can lead to disease.  If not, only genetic variation would cause disease, and that clearly isn't so!  We write about this all the time on MT.  We just aren't nearly as ready to accept that we know definitively what those risk factors and their associated risks are.  Nor that everyone is equally at risk from every factor.  &lt;br /&gt;&lt;br /&gt;Some of the optimal exposure levels in the list probably come under the category of 'wouldn't hurt', but public health measures are, by design, meant to be population-based, and the economic costs of encouraging lifestyle changes on a population level are not trivial.  Nor is the cost of lost credibility when the risk factors turn out to be less important than we've been told after all. &lt;br /&gt;&lt;br /&gt;Worse, risk is always and necessarily estimated retrospectively by relating outcomes quantitatively to exposure histories.  But what we want to know is the future  risk, and we know very well that we cannot predict the mix or amount of exposures to who-knows-what risk factors in the future.  This is a deeply troubling problem, since major changes in risk for many or even most complex disease have occurred, often because of unclear behaviors or exposures, just in the past 50 years or so.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;&lt;/div&gt;&lt;div&gt;So, here's the safest conclusion to date -- do (most) everything in moderation, and don't worry about it.  Something will get you in the end, so try to have the best time you can before that.&lt;/div&gt;&lt;div&gt;&lt;div&gt;&lt;div class="MsoNormal" style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;/div&gt;&lt;/div&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-5213300181909312003?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/5213300181909312003/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/does-salt-really-cause-cancer.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/5213300181909312003'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/5213300181909312003'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/does-salt-really-cause-cancer.html' title='Does salt really cause cancer?'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-7208479035013370436</id><published>2011-12-07T05:54:00.001-05:00</published><updated>2011-12-07T05:54:00.091-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='human exceptionalism'/><category scheme='http://www.blogger.com/atom/ns#' term='Nicola Clayton'/><category scheme='http://www.blogger.com/atom/ns#' term='intelligence'/><category scheme='http://www.blogger.com/atom/ns#' term='corvids'/><category scheme='http://www.blogger.com/atom/ns#' term='tool use'/><title type='text'>The intelligent bird brain</title><content type='html'>Nicola Clayton, zoologist and Professor of &lt;span class="standfirst"&gt;&lt;span id="ctl00_ctl00_ContentPlaceHolder1_ArticleContentHolder_lblStandfirst2"&gt;Comparative Cognition in the Department of Experimental Psychology &lt;/span&gt;&lt;/span&gt;at the University of Cambridge, UK, and recent guest on the BBC &lt;a href="http://www.bbc.co.uk/iplayer/episode/b017cd0v/The_Life_Scientific_Nicky_Clayton/"&gt;radio program&lt;/a&gt;, "The Life Scientific," believes that intelligence has evolved more than once, in apes and in birds -- corvids to be precise.&amp;nbsp; That's primarily crows, jays, ravens and jackdaws.&amp;nbsp; In a 2004 &lt;i&gt;Science &lt;/i&gt;&lt;a href="http://www.sciencemag.org/content/306/5703/1903.full?sid=6fb2383e-8af5-45fa-adf9-0448b78a1e6f"&gt;paper&lt;/a&gt;, she and a co-author, Nathan Emery, wrote that&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;...complex cognition depends on a "tool kit" consisting of causal  reasoning, flexibility, imagination, and prospection. Because corvids  and apes share these cognitive tools, we argue that complex cognitive  abilities evolved multiple times in distantly related species with  vastly different brain structures in order to solve similar  socioecological problems.&amp;nbsp; &lt;/blockquote&gt;The socioecological problems corvids and great apes have evolved to solve, say Emery and Clayton, include finding and keeping perishable foods over time and space, and understanding individual relationships in social groups. &amp;nbsp;Emery and Clayton propose that corvids are more intelligent than any other bird, except perhaps parrots, and their intelligence rivals that of most non-human primates. Indeed, Clayton calls corvids "feathered apes".&amp;nbsp; "You only have to look in the beady eye and see them watching you," she says.&lt;br /&gt;&lt;br /&gt;Clayton told the radio presenter that she had her original inspiration jointly with Nathan Emery, now her husband, who was studying primates when they met as students. &amp;nbsp;He was working on eye gaze, on which there's been a lot of work in primates, and they wondered whether they could collaborate on a project having to do with that.&amp;nbsp; But, instead, Clayton was inspired by her daily walks around campus when she'd watch the local scrub jays stealing food from students eating lunch on the lawn.&lt;br /&gt;&lt;br /&gt;Not only would these birds hide what they'd stolen for later, but Clayton&amp;nbsp;&lt;a href="http://www.sciencemag.org/content/312/5780/1662.full.pdf?keytype=ref&amp;amp;siteid=sci&amp;amp;ijkey=QxPAW7.omUfE2"&gt;observed&amp;nbsp;&lt;/a&gt;that when they knew they'd been watched as they hid their find, they would re-hide it when no other birds were watching.&amp;nbsp; This led Clayton and Emery to conceive of the corvid "theory of mind".&amp;nbsp; Previously, it had been thought that only great apes and humans could imagine the future, and put themselves in it, but to Clayton the fact that these jays were sensitive to others watching, and changed their behavior based on that knowledge, meant that they are able to make interesting inferences and deductions that most other animals cannot.&amp;nbsp; Dogs bury bones "but nobody has shown they are capable of putting themselves into another's shoes."&amp;nbsp; &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;The crow has a brain significantly larger than would be predicted for its body size, and it is relatively the same size as the chimpanzee brain. The relative size of the forebrain in corvids is significantly                         larger than in other birds (with the exception of some parrots), particularly those areas thought to be analogous to the mammalian prefrontal cortex: the nidopallium and mesopallium. This enlargement of the “avian prefrontal cortex” may reflect an increase in primate-like intelligence in corvids.&amp;nbsp;&lt;/blockquote&gt;&lt;table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://1.bp.blogspot.com/-jhmWeN9rC2E/Tt4ioRKSDNI/AAAAAAAACL8/7EuBdn5HejU/s1600/F3.medium.gif" imageanchor="1" style="margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" height="218" src="http://1.bp.blogspot.com/-jhmWeN9rC2E/Tt4ioRKSDNI/AAAAAAAACL8/7EuBdn5HejU/s320/F3.medium.gif" width="320" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;Illustration of the four nonverbal cognitive tools displayed by corvids  and apes, which are proposed as the basis for complex                               cognition: causal reasoning (New  Caledonian crow and chimpanzee tool use), imagination (insight in ravens  and role taking                               in chimpanzees), flexibility (western  scrub jays' flexible memory for degraded and fresh food items and  tactical deception                               in apes), and prospection (western scrub  jays recaching food and chimpanzees carrying stone tools). These  cognitive tools                               interact in different ways to produce  complex cognition. [Drawing by C. Cain].&amp;nbsp; From &lt;a href="http://www.sciencemag.org/content/306/5703/1903.full?sid=6fb2383e-8af5-45fa-adf9-0448b78a1e6f"&gt;&lt;i&gt;Science&lt;/i&gt;&lt;/a&gt;.&amp;nbsp; &lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;In addition to food stealing and hiding behavior, evidence of corvid intelligence, according to Clayton, includes their use of tools, with tool use defined as “the use of an external object as a functional extension of mouth, beak, hand, or claw, in the attainment                         of an immediate goal".&amp;nbsp; They make these tools in ways that suggest to Clayton that they have complex cognition.&amp;nbsp; &lt;br /&gt;&lt;br /&gt;These birds "travel mentally in time and space", that is, they plan for the future, including for tomorrow's breakfast, as described &lt;a href="http://www.nature.com/news/2007/070221/full/news070219-6.html"&gt;here&lt;/a&gt;. &amp;nbsp;They can remember where they've hidden food; Clark's nutcrackers cache up to 30,000 pine seeds which they can retrieve up to 6 months later.&amp;nbsp; Some corvids cache perishable foods, but don't eat them past their sell-by dates.&amp;nbsp; These birds can watch others caching foods and pilfer them later, when the storer's not watching.&amp;nbsp; Or they'll hide their stores behind barriers so that observers can't see its exact location, as in the video. &lt;br /&gt;&lt;br /&gt;&lt;iframe allowfullscreen="" frameborder="0" height="315" src="http://www.youtube.com/embed/y_MnwNyX0Ds" width="560"&gt;&lt;/iframe&gt;&lt;br /&gt;&lt;br /&gt;These birds may well be able to solve these 'socioecological' problems, but we do have to be careful about defining 'intelligence' in human terms, which is at least a bit circular.&amp;nbsp; After all, other birds, closely related, relatively speaking, do perfectly well at what they do, and that involves using the brain to solve problems, assess their situation, and so on.&amp;nbsp; This doesn't take away from corvid achievements, of course, but helps put things in perspective.&amp;nbsp; If corvids actually have markedly better abilities at some kinds of problems solving that we seem to relate to our own, and are closely related to species that don't, then it could suggest that something relatively simple can lead to major jumps in such abilities.&lt;br /&gt;&lt;br /&gt;Still, it's always interesting when human, or primate exceptionalism is challenged.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;nbsp; &lt;br /&gt;&lt;div class="publication" id="pub_8420"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-7208479035013370436?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/7208479035013370436/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/intelligent-bird-brain.html#comment-form' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7208479035013370436'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/7208479035013370436'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/intelligent-bird-brain.html' title='The intelligent bird brain'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/-jhmWeN9rC2E/Tt4ioRKSDNI/AAAAAAAACL8/7EuBdn5HejU/s72-c/F3.medium.gif' height='72' width='72'/><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-9086392543665868410</id><published>2011-12-06T05:02:00.009-05:00</published><updated>2011-12-06T22:49:21.265-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='microbiome'/><category scheme='http://www.blogger.com/atom/ns#' term='bioethics'/><title type='text'>Whose microbiome is it?  Take an educated guess</title><content type='html'>Carl Zimmer's articles in the New York Times are usually a treat.&amp;nbsp; Indeed, he's one of the best science journalists around.&amp;nbsp; But his &lt;a href="http://www.nytimes.com/2011/12/04/opinion/sunday/our-microbiomes-ourselves.html?_r=1&amp;amp;partner=rss&amp;amp;emc=rss"&gt;op/ed piece&lt;/a&gt; on Sunday told only part of the story.&lt;br /&gt;&lt;br /&gt;Called "Our Microbiomes, Ourselves", Zimmer describes the efforts to sequence entire populations of microbes -- the microbiome -- in various orifices of the human body, and he considers the ethical questions this is bringing to light.&amp;nbsp; Long considered to be separate from us, recent understanding has shown that many bacterial species are vital to our survival.&amp;nbsp; The bacteria in our gut are the classic and best example: we can't live without them in our intestines because our digestion depends on it.&amp;nbsp; So they may have their own species name, but in a very real way, and evolutionarily as well as today, their genome is really our genome, too (and to some extent vice versa). &lt;br /&gt;&lt;br /&gt;Zimmer proposes a scenario whereby the microbiome of someone's nostril is sequenced, and a unique microbe is identified, and found to have pharmaceutical uses, and industry goes on to make millions from the new drug that results.&amp;nbsp; If it was found in your nose, he asks, do you deserve a share of the profits?&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;It is a tricky question, because it defies our traditional notions of  property and justice. You were not born with the germ in your nose; at  some point in your life, it infected you. On the other hand, that  microbe may be able to grow and reproduce only in a human nose. You  provided it with an essential shelter. And its antibiotics may help keep  you healthy, by killing disease-causing germs that attempt to invade  your nose.&lt;/blockquote&gt;&lt;blockquote class="tr_bq"&gt;Welcome to the confusing new frontier of ethics: our inner ecosystem. &lt;/blockquote&gt;But, while the specific scenario might be new, the question of who profits from stuff going on in or coming out of other people's bodies certainly isn't.&amp;nbsp; As a recent book reminded us all, Henrietta Lacks' tumor cells have been used since the 1960's for various profit-making purposes, but she and her family got nothing from her unwitting donation of cells.&amp;nbsp; From best-selling books written about neurological case histories to clinical testing of new drugs to the reaping of cells for research, there's nothing new here.&lt;br /&gt;&lt;br /&gt;Some bioethicists, Zimmer says, believe that people's private microbiomes should be kept private, just as people's genomes should be, because the microbiome may hold clues to future illness.&amp;nbsp; But, there's nothing new here, either.&lt;br /&gt;&lt;br /&gt;And, &lt;br /&gt;&lt;blockquote class="tr_bq"&gt;As scientists get to know the microbiome better, they are also looking  for new medical treatments: after all, most antibiotics were first  discovered in bacteria and fungi. Michael Fischbach, a biologist at the  University of California, San Francisco, and his colleagues have  discovered a wealth of promising druglike molecules made by microbes in  human bodies. &lt;/blockquote&gt;Zimmer adds that microbiomes may be harvested from subjects in poor countries, because of their potential usefulness to pharmacology or to understanding disease risk.&amp;nbsp; But that's an old story, too -- pharmaceutical companies have been doing clinical trials in poor countries for decades because it's cheaper and there's less regulation.&amp;nbsp; And agribusiness has inflamed many countries for raiding them of commercially modifiable plants and then selling them at high cost to farmers, making them dependent on buying seeds annually, rather than beneficiaries of royalties.&lt;br /&gt;&lt;br /&gt;Sequencing the microbiome of an entire town's sewage system might reveal a lot about the entire town's health, but, Zimmer asks, would permission be required from each person living in the town?&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;The microbiome poses another bioethical balancing act, between the  interests of microbe hosts and the public at large. If scientists become  too consumed with protecting the individuals they study, research on  the microbiome could slow. &lt;/blockquote&gt;So, Zimmer poses some interesting questions about the ethics of microbiome research, but there's nothing new here.&amp;nbsp; The same questions of who owns what and who should profit apply to all biomedical research. And, we're willing to bet that, as usual, the answers will favor the researchers.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-9086392543665868410?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/9086392543665868410/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/whose-microbiome-is-it-take-educated.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/9086392543665868410'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/9086392543665868410'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/whose-microbiome-is-it-take-educated.html' title='Whose microbiome is it?  Take an educated guess'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-4257346661207676339</id><published>2011-12-05T08:18:00.001-05:00</published><updated>2011-12-05T08:21:41.922-05:00</updated><title type='text'>CoE #42</title><content type='html'>&lt;a href="http://3.bp.blogspot.com/-I4MOu4hFjx8/TtzFM2yQzeI/AAAAAAAACL0/8yYGDcwnuB0/s1600/CoE.jpg" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="200" src="http://3.bp.blogspot.com/-I4MOu4hFjx8/TtzFM2yQzeI/AAAAAAAACL0/8yYGDcwnuB0/s200/CoE.jpg" width="200" /&gt;&lt;/a&gt;This month's &lt;a href="http://blogs.scientificamerican.com/ocelloid/2011/12/05/carnival-of-evolution-42-answers-to-life-the-universe-and-everything/"&gt;Carnival of Evolution&lt;/a&gt; is up over at &lt;a href="http://blogs.scientificamerican.com/ocelloid/"&gt;The Ocelloid&lt;/a&gt;, on the Scientific American blog site. &amp;nbsp;Evolutionary tales from many angles. &lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-4257346661207676339?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/4257346661207676339/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/coe-42.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4257346661207676339'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1812431336777691886/posts/default/4257346661207676339'/><link rel='alternate' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/coe-42.html' title='CoE #42'/><author><name>Anne Buchanan</name><uri>http://www.blogger.com/profile/09212151396672651221</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/-I4MOu4hFjx8/TtzFM2yQzeI/AAAAAAAACL0/8yYGDcwnuB0/s72-c/CoE.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1812431336777691886.post-2761850084879065207</id><published>2011-12-05T05:08:00.000-05:00</published><updated>2011-12-05T12:44:19.276-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Brca1'/><category scheme='http://www.blogger.com/atom/ns#' term='gene mapping'/><category scheme='http://www.blogger.com/atom/ns#' term='complexity'/><category scheme='http://www.blogger.com/atom/ns#' term='Nbr1'/><title type='text'>Next to ... meaningless</title><content type='html'>We &lt;a href="http://ecodevoevo.blogspot.com/2011/10/identifying-candidate-genes-theory-and.html"&gt;posted&lt;/a&gt; a few weeks ago about a gene mapping project we're involved in, and the myriad difficulties in identifying genes that could be responsible for the variation in craniofacial shape in two strains of mice. &amp;nbsp; I'm still slogging through map intervals, though I am willing to say out loud that I can now see the end. &lt;br /&gt;&lt;br /&gt;&lt;table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; text-align: left;"&gt;&lt;tbody&gt;&lt;tr&gt;&lt;td style="text-align: center;"&gt;&lt;a href="http://4.bp.blogspot.com/-mkarGancIIw/TtvsStrBcwI/AAAAAAAACLs/2nISqIMHsCg/s1600/brca1.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"&gt;&lt;img border="0" height="320" src="http://4.bp.blogspot.com/-mkarGancIIw/TtvsStrBcwI/AAAAAAAACLs/2nISqIMHsCg/s320/brca1.jpg" width="211" /&gt;&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;tr&gt;&lt;td class="tr-caption" style="text-align: center;"&gt;Brca1 expression, developing mouse &lt;br /&gt;embryo.&amp;nbsp;Image from &lt;a href="http://134.76.20.6/cgi-bin/mgrqcgi94?APPNAME=genepaint&amp;amp;PRGNAME=query_thumbnail&amp;amp;ARGUMENTS=-AQ70014357617008,-AMH,-A2991,-Aview"&gt;GenePaint&lt;/a&gt;&lt;/td&gt;&lt;/tr&gt;&lt;/tbody&gt;&lt;/table&gt;I haven't revised my sense of what this all means: The function of many genes is still unknown -- indeed, most genes are expressed in multiple tissues throughout the body, so often it's surely true that a gene's multiple functions are still unknown. &amp;nbsp;And, because many genes are named for a disease they have been discovered to be associated with, or for a single tissue in which they are expressed at a specific time, even though they can have many other functions, it's hard to know if they are relevant or not (e.g., a gene in one of the intervals I was characterizing last week was named for its involvement in follicle maturation, but it turns out it's expressed in many tissues in the developing mouse embryo, including the head, so it's hard to rule it out as possibly contributing to the development of traits we are interested in). &lt;br /&gt;&lt;br /&gt;I also found the Brca1 gene in one of the intervals I was looking at, the "breast cancer 1" gene. &amp;nbsp;Candidate? &amp;nbsp;This is one of the genes that, when mutated, is associated with high risk of early onset breast cancer. &amp;nbsp;But, in spite of its name, it's not a gene 'for' breast cancer.&amp;nbsp; It's a DNA repair gene, and it's expressed in a variety of organs in the body, at various developmental stages. &amp;nbsp;In the picture to the left, the darker stain in the section of mouse embryo represents Brca1 expression; it's in the brain, the facial region, the liver, the intestine, the lungs, and so on.&lt;br /&gt;&lt;br /&gt;And it's bad enough to be named after a function that you only have when you're mutated, that ignores your major purpose in life. &amp;nbsp;But, here's the height of indignity for a poor gene: the gene that sits next to Brca1 on mouse chromosome 11 is called Nbr1, which is short for "next to BRCA1" gene.&amp;nbsp; What a way to go through life!&amp;nbsp; This gene was first identified in the mid 1990s, and was of interest because of its chromosomal proximity to Brca1. &amp;nbsp;But its function is still not known. &amp;nbsp;If you look it up in GeneCards, which is a compendium of what's known about tens of thousands of genes, you find this:&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The&amp;nbsp;encoded protein contains a B-box/coiled coil motif, which is present in many genes with transformation potential, but&amp;nbsp;the function of this protein is unknown. This gene is located on a region of chromosome 17q21.1 that is in close&amp;nbsp;proximity to tumor suppressor gene BRCA1. Three alternatively spliced variants encoding the same protein have been&amp;nbsp;identified for this gene. (provided by RefSeq)&lt;/blockquote&gt;And, listed under "Function":&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;span class="Apple-style-span" style="font-family: inherit;"&gt;Acts probably as a receptor for selective autophagosomal degradation of ubiquitinated targets.&lt;/span&gt;&lt;/blockquote&gt;That is, it may be involved in the recycling of proteins within cells. &amp;nbsp;Maybe.&lt;br /&gt;&lt;br /&gt;This in itself has nothing whatever to do with breast cancer, nor with being 'near' to breast cancer whatever that might mean!&amp;nbsp; Clusters of genes near to each other on their respective chromosome often comprise gene families -- that is, genes that arose by miscopying of an existing gene so that in the descendant cell there are two adjacent copies of the ancestral gene.&amp;nbsp; This kind of thing is a regular if rare occurrence and is, indeed, a major way that genomes evolve:&amp;nbsp; duplicate genes can initially provide redundancy for the parent gene's functions, but one of the two can then diverge through mutational changes to take on a new function.&amp;nbsp; But the functions need not be relevant even to the same tissue.&lt;br /&gt;&lt;br /&gt;And unrelated genes that happen to be nearby on a chromosome can sometimes, but certainly need not, be expressed in the same cell types nor involved in the same functions.&amp;nbsp; So being 'near' to&amp;nbsp; a 'breast cancer' gene and hence even mildly suspected of being related to breast cancer, or any cancer, is a nefarious case of guilt by association!&lt;br /&gt;&lt;br /&gt;Too often we are driven by labels rather than using them in a neutrally informative way.&amp;nbsp; There are pressures to coin a name for a gene you've discovered, just as there are incentives to give a new species name to a fossil you've discovered.&amp;nbsp; Our reward system that is too often based on publicity and marketing is to some extent responsible, along with the normal everyday vanity to which we are perhaps all subject.&lt;br /&gt;&lt;br /&gt;But it's not good for science.&lt;br /&gt;&lt;br /&gt;These are but two examples of why identifying candidate genes for traits of interest is difficult. &amp;nbsp;And, these are genes we know something about. &amp;nbsp;When nothing's known, neither where a gene is expressed or what it does, that gene can't be considered a candidate for anything, even though it certainly does something. &amp;nbsp;And that's true for a lot of genes.&lt;br /&gt;&lt;blockquote class="tr_bq"&gt;&lt;/blockquote&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1812431336777691886-2761850084879065207?l=ecodevoevo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://ecodevoevo.blogspot.com/feeds/2761850084879065207/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://ecodevoevo.blogspot.com/2011/12/next-to-meaningless.html#comment-form' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/fee
